1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
2 years ago
11

How does the width of the black Iodine starch complex of each potato block compare to the others? Why?

Biology
1 answer:
9966 [12]2 years ago
3 0

Answer: I was thinking the same thing lol.

Explanation:

I am so confused and I hate science.

You might be interested in
In what way should scientists contribute to the discussion on global warming and climate change?
horsena [70]
Scientists cannot provide accurate information on environmental conditions
8 0
2 years ago
ASAP
yanalaym [24]
B . , because I remember this
3 0
2 years ago
Please, i need this done asap, its timed too.
Arlecino [84]
B is the correct answer
5 0
3 years ago
The total area of land and water ecosystems and individuals needs to obtain food shelter home heating travel and waste absorptio
salantis [7]
B. And environmental problem should be correct
3 0
2 years ago
Read 2 more answers
Which of the following statements is TRUE about competition between organisms with the same needs when resources are limited?
netineya [11]

Answer:

animals are the only organisms that compete for resources

Explanation:

this is due to the fact that plants take up resources passively, a method which doesn't require them to waste any energy, however in the case of resources, is not very effective. suppose there was a bit of water scarcity in your area, and a plant and you both need water for survival. obviously, the plant cant possibly do anything to receive these resources, as it is just a plant. its survival is based merely on the chance that you pour water into it. this is not the case for animals, which, like us, actively collect and gather resources, and use them to our advantage.  therefore, animals are the only animals that compete for resources

6 0
3 years ago
Other questions:
  • How can a person prepare his or her body for an adventure to an extreme environment?
    11·2 answers
  • Which of the following terms describes this type of information ?
    9·1 answer
  • how does aerobic and anaerobic respiration work together to provide a continuos work together to provide a continuous supply of
    6·1 answer
  • Students observed that when they played violent video games, they experienced an increase in heart rate. One student group condu
    10·2 answers
  • What are the two main a biotic factor that affect organisms in a marine ecosystem​
    13·1 answer
  • Although we consider it non-fat, skim milk actually has very low levels of lipids. therefore, it should test positive with sudan
    9·2 answers
  • Please help ASAP!!!
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Who is more closely related, lizards of the same ecomorph, or lizards that live on the same island?​
    9·1 answer
  • Particulates can:_____.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!