1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
6

Choose the mass extinction of most interest to you.

Biology
1 answer:
ZanzabumX [31]3 years ago
8 0

Answer:

im going to say End Triassic is my favorite you can go on to wiki searching this and find all you are looking for.

something thats helps me is printing out he form and highlighting everything thats important and working from there

Explanation:

You might be interested in
Paramecium caudatum uses its cilia to _____.
babunello [35]
<span>Sweep prey organisms, along with some water, through the oral groove, and into the mouth opening. </span>
5 0
3 years ago
Read 2 more answers
The small motile gametes fertilize ovum
tankabanditka [31]

Answer

Gametes that fertilize an ovum are called the sperms

Explanation

The reproductive cells of an organism are called the gametes or sex cells. Female sex cells are the ova/egg where as male sex cells are the sperms. The sperms are stored in the scrotum after their production in the male testes where as the eggs for females mature in female ovaries. During fertilization, sex cells meet in the Fallopian tube.



5 0
3 years ago
Which of these processes involve separation of grains?
grin007 [14]

B, burrowing action of earthworm

4 0
3 years ago
A horse has a coat color that appears to be a mix between its mother's coat color and its father's coat color. The horse is most
mr_godi [17]
If I'm not mistakened, the answer is D

Hope this helps :)
7 0
3 years ago
What is carbon emissions responsible for?
AVprozaik [17]
Carbon emissions are responsible for the global warming crisis. More specifically they are responsible for bad air quality. Greenhouse gases. Sometimes also cancers
7 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is assessing the fetal heart rate in a pregnant client with diabetes during the first stage of labor. at what time int
    13·1 answer
  • Please help with this!!:
    5·1 answer
  • Plant cells contain another organelle that functions as a storage tank for excess glucose or starch that is the
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A particular plant has 10 pairs of chromosomes in each cell. For each of the plant's gametes, how many genetic combinations are
    6·2 answers
  • Can anyone help me with a couple of questions in Anatomy and Physiology?
    9·1 answer
  • A ___ is a type of turbine used to capture the energy of moving air
    14·2 answers
  • What does that mean and how can our skin color be so varied?
    6·1 answer
  • 1. Why does a change in the structure of a protein matter?
    15·1 answer
  • Which of the following statements below are TRUE about Keystone Species? Pick all that are correct
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!