1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NemiM [27]
2 years ago
9

Will give brainiest if brainly let me

Law
2 answers:
lilavasa [31]2 years ago
7 0

Answer:

<em><u> Moon revolves around the earth and while revolving, its surface gets illuminated by sun. ... Moon start its cycle as a new moon, then becomes full moon and then back to new moon</u></em><em><u>.</u></em>

<em><u>t</u></em><em><u>h</u></em><em><u>i</u></em><em><u>s</u></em><em><u> </u></em><em><u>i</u></em><em><u>s</u></em><em><u> </u></em><em><u>y</u></em><em><u>o</u></em><em><u>u</u></em><em><u>r</u></em><em><u> </u></em><em><u>a</u></em><em><u>n</u></em><em><u>s</u></em><em><u>w</u></em><em><u>e</u></em><em><u>r</u></em><em><u> </u></em><em><u>m</u></em><em><u>a</u></em><em><u>r</u></em><em><u>k</u></em><em><u> </u></em><em><u>m</u></em><em><u>e</u></em><em><u> </u></em><em><u>b</u></em><em><u>r</u></em><em><u>a</u></em><em><u>i</u></em><em><u>n</u></em><em><u>l</u></em><em><u>i</u></em><em><u>s</u></em><em><u>t</u></em><em><u> </u></em><em><u>p</u></em><em><u>l</u></em><em><u>z</u></em><em><u>.</u></em>

NikAS [45]2 years ago
6 0

Answer:

the Moon revolves around the earth and while revolving its surface gets illuminated by thevsun. The change in the surface of the moon being illuminated by sun forms a lunar cycle

You might be interested in
What is meant by ""insure domestic tranquility"" in the preamble of the u.S. Constitution?
iris [78.8K]
The Framers had good reason to seek to “insure” domestic tranquility. Literally “domestic Tranquility” means peace and quiet at home—at home in America, as opposed to in other nations. Tranquility for the Framers meant the absence of riots, rebellions, and similar symptoms of social disorder.
5 0
3 years ago
From which criminological theory is the insanity defense derived from?
Jet001 [13]

Answer:

the M'naghten rules of 1843

5 0
3 years ago
2. This newspaper headline describes an event in
Tanya [424]

Answer:d

Explanation:

Homeland security and to control public violence

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Name the two ways to propose an amendment to the Constitution. Then name the two ways to ratify an amendment to the Constitution
Korvikt [17]

Under Article V of the Constitution, there are two ways to propose and ratify amendments to the Constitution. To propose amendments, two-thirds of both houses of Congress can vote to propose an amendment, or two-thirds of the state legislatures can ask Congress to call a national convention to propose amendments.

Hope this helps!

Please give brainliest!

7 0
3 years ago
Other questions:
  • Why would a city want to annex a suburban neighborhood?
    12·2 answers
  • Which term is synonymous with natural rights, according to Enlightenment philosophers?
    14·1 answer
  • Drug Users will have ____ psychological changes<br><br> A. Mild<br> B. Significant <br> C.no
    8·2 answers
  • What is the hardest part of being a Jury Member in Court?
    14·2 answers
  • What are examples of procedural laws?
    15·1 answer
  • Please help on any one that you know thank you
    6·1 answer
  • What type of professional could BEST help the relationship between the police and the citizens ?
    10·1 answer
  • Explain the process of choosing and appointing a supreme court justice
    14·1 answer
  • IF YOU BECOME ANGRY OR UPSET, YOU SHOULD: A. Control your emotions while driving B. Park the car and "cool down" before driving
    7·1 answer
  • An attorney renowned for his contributions to the causes of labor, racial equality, and civil liberties was:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!