1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
9

Hiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii????????????????

Chemistry
2 answers:
melomori [17]3 years ago
4 0
Heyyyyyyyyyyyyyyyyyy!!!
algol133 years ago
4 0

Answer:

heyyyy

Explanation:

heyyy

You might be interested in
If a girl is 99 lb's and she eats a lb of nacho does that mean she is 1% nacho
Julli [10]
No. that does not mean that
4 0
3 years ago
Read 2 more answers
Which is the atomic number of an atom with six valence electrons
Finger [1]
6 because all atomic numbers equal the number of electrons
7 0
3 years ago
Neutral atom contains 22 protons and 24 neutrons​
dezoksy [38]

Answer:

And contains 22 electrons

5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
The indicator methyl red has different molecular structures at high and low pH.
Novosadov [1.4K]

Answer:

a. True

Explanation:

Methyl red is an indicator widely used in quality control of oxides as Zinc oxide in the titration with sulfuric acid.

As is used in titrations of acid-base reactions the indicator change in colour. Is red when the pH < 4.4 (Acidic Solutions) and is yellow when pH > 6.2 (Neutral-Basic solutions).

A change in colour means the structure of the indicator is changing with pH. Thus, the answer is:

<h3>a. True </h3>

6 0
3 years ago
Other questions:
  • What is the amount of mass in each given unit of volume?
    12·1 answer
  • Caculate the kinetic energy in J of an electron moving at<br> 6.00x 10 to the sixth power m/s.
    9·1 answer
  • Describe the sequence of events in the formation of an evaporite
    14·1 answer
  • To study Earth’s interior, geologists often rely on indirect methods, such as evidence from fossils. true or false
    14·2 answers
  • When the reddish-brown mercury(ii) oxide (hgo) is heated, it decomposes to its elements, liquid mercury metal and oxygen gas. if
    15·1 answer
  • State one function of Emitter??​
    6·1 answer
  • A brick is resting on a smooth, level surface. A student applies a force of
    10·1 answer
  • A reaction has a theoretical yield of 124.3 g SF6, but only 113.7 g SF6 are obtained in the lab, what is the percent yield of SF
    7·1 answer
  • Please can you help me from 1 to 6
    8·1 answer
  • A sugar crystal contains approximately 1. 9×1017 sucrose (c12h22o11c12h22o11) molecules. part a what is its mass in mgmg ? expre
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!