1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
2 years ago
8

What do this object do in enviromental science

Biology
1 answer:
lilavasa [31]2 years ago
6 0

Answer:

This object spins turning kinetic energy into electricity.

Explanation:

When wind hits one of the blades, it starts to spin. The more it spins, the more electricity it creates. Brainliest pls

You might be interested in
Evidence for evolution includes the presence of _______________________, which are similar structures shared by different specie
3241004551 [841]
Homologous structures (D)
5 0
3 years ago
Read 2 more answers
One societal issue scientist will address ysing the human genome
Zolol [24]
Is this like on a test or like homeowork?

8 0
3 years ago
The farther you live from an ocean, the more likely your climate will be a
tatiyna
Most likely it would be more dry

6 0
3 years ago
What determines weather a metamorphic rock foliated or non-folited?
Kaylis [27]
Foliated rocks have bands, or layers( whatever you want to call it) unifoliated rocks don't have that I think.
7 0
3 years ago
How does the structure of a white blood cell aid in its function?
nikdorinn [45]
The function of White Blood Cells (WBC) is to defend the body from various infections. They produce antibodies that help detect and fight the presence of foreign elements (say germs) in the body. They strengthen the defense mechanism, thereby improving the immune system of the body against germs
7 0
3 years ago
Read 2 more answers
Other questions:
  • Dr. mclear is a scientist studying heredity. she wants to isolate the basic unit for the transmission of heredity, which is a(n)
    7·1 answer
  • Difference between species evenness and species richness
    15·2 answers
  • Someone help me answer these questions, I’ll give brainlyyyy :))
    14·1 answer
  • Which is true of all animals, but not of all plants?
    8·2 answers
  • A 75-year-old patient diagnosed with acute renal failure underwent hemodialysis, which was provided on october 14. three evaluat
    11·1 answer
  • Carbohydrates are used by the body as a source of quick energy, and are made up of
    9·1 answer
  • Differentiating between DNA and RNA
    10·1 answer
  • 5 ejemplos de biomoléculas orgánicas y inorganicas
    5·1 answer
  • 'the fern are more terrestrially adapted 'explain this statement​
    5·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!