1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
e-lub [12.9K]
3 years ago
6

Recall what you know about hypertonic, hypotonic, and isotonic solutions. When an environment is hypotonic, what happens

Biology
1 answer:
Serga [27]3 years ago
7 0
Hypotonic solutions are lowly concentrated solutions
Hypertonic are highly concentrated solutions
While isotonic have equally concentrated

When a cell is placed in a hypotonic sol water moves out of the cell by osmosis making the cell flaccid
You might be interested in
Cell division is an example of cellular _______, whereas cell differentiation is an example of cellular ________.
-BARSIC- [3]

Answer:

Growth;  development

8 0
3 years ago
Read 2 more answers
The process of phagocytosis involve all of the following except
evablogger [386]

Hello, I figured your question was missing its options so I went online to find them. Here they are:

The process of phagocytosis involves all of the following EXCEPT :

a. adhesion.

b. secretion of cytotoxins.

c. elimination.

d. vesicle fusion.

e. chemotaxis.

Answer:

The correct answer is: b) secretion of cytotoxins.

Explanation:

Phagocytosis is a mechanism performed by cells in which the plasma membrane engulfs a large particle. Phagocytosis is used by cells in the immune system to ingest pathogens like viruses and bacteria.

Phagocytosis consists of many steps:

  1. activation - the phagocytes that were resting are activated in the inflammatory response when a pathogen enters the body.
  2. chemotaxis  - this refers to the process in which the phagocyte moves to the pathogen by following the chemical factors released by these germs.
  3. adhesion - the phagocyte attaches to the pathogen.
  4. ingestion /vesicle fusion - the phagocyte sends pseudopods to engulf the pathogen, and places it in a phagosome, which is an endocytic vesicle. The phagosome and the phagocyte will fuse so the pathogen gets inside.
  5. elimination - the pathogen is destroyed in the phagocyte by the lysosomes present in it.

<u>The</u><u> secretion of cytotoxins</u><u> is not a part of the phagocytosis, and is a process exclusive to </u><u>T cells</u><u> (leukocytes that lack the ability to phagocyte).</u>

5 0
3 years ago
Which of the following correctly describes the general trend in the evolution of hominid teeth?
goblinko [34]
Is there a image?..
Im confused.
7 0
2 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Why is it important that a drop of condensate be suspended from the thermometer during a distillation?
MissTica

Distillation is the process of separation in which the volatile parts of a liquid mixture are separated by selective boiling and condensation. This process may lead to partial separation or complete separation. Distillation is employed for a considerable number of commercial processes such as the production of alcohol, kerosene gasoline, etc. During a distillation, it is important that a drop of condensate be suspended from the thermometer because it allows steady distillation and a stable temperature.

6 0
3 years ago
Other questions:
  • What human activity destroys the most natural animal habitats
    6·2 answers
  • Which statement explains why earthquakes tend to be deeper near subduction zones?
    9·1 answer
  • ASAP Mitosis and Meiosis have all of the following in common, except: A. Both duplicate their DNA first B. Both result in cell d
    9·1 answer
  • Part F
    11·1 answer
  • A marine ecologist counts the number of crabs in three different intertidal regions that are each two hectares. The crab counts
    10·1 answer
  • Someone please help me!! I will mark brainlest!
    5·1 answer
  • Which part of the bean see stores fpod for the early development of new plant​
    14·1 answer
  • Rachel Carson wrote in Silent Spring, "The chemical war is never won, and all life is caught in the crossfire." Respond
    11·2 answers
  • PLEASE HELP! BIOLOGY
    12·1 answer
  • What is created when plants convert the sun's energy?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!