1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
3 years ago
9

Living cells depend on a precise balance of water and solutes. which term describes the control of the gain or loss of water and

dissolved solutes, such as the ions of nacl and other salts.
Biology
1 answer:
Brums [2.3K]3 years ago
6 0
The term in question is referred to as osmoregulation.
Since water and its soluted metabolites are key to the survival and normal function of the cell, there are many membrane proteins that regulate the exchange of water, ions and other osmolites between the cell and its surroundings. 
You might be interested in
Which of the following occurs at convergent plate boundaries?
goblinko [34]

The correct answer is:

d. all of the above

Explanation:

In plate tectonics, a convergent boundary, also recognized as a destructive plate boundary, is a section of active deformation where two or more tectonic plates or parts of the lithosphere are near the edge of their life cycle. If two tectonic plates strike, they create a convergent plate boundary.


6 0
3 years ago
Read 2 more answers
_________ is an agent that kills bacteria. germicide antiseptic bactericidal antiviral
umka21 [38]
The agent that kills bacteria is called bactericidal. Bactericidal agents act directly by destroying the present bacteria. It is also different from bacteriostatic, because bacteriostatic means the inhibition of the spread and growth of bacteria only.
4 0
3 years ago
Monty is continuing with his journal of observations of the Moon for a month. At the half way point, the Moon is fully lit (Full
musickatia [10]
Actually i think it would be a waxing crescent because it takes two weeks to turn full moon again so one week equals three phases two weeks though equals 7 because of the extra two days from the two weeks and thoose two days are  new moon
4 0
4 years ago
In general, what type of air masses and front could create a big thunderstorm?
Ivan
Warm Front would be your answer
3 0
2 years ago
DO NOT SEND ME PDFS!!!!!! Answer with a paragraph
Andrews [41]

short whiskers and short whuskers

7 0
3 years ago
Other questions:
  • How does stormwater management help control flooding in cities? (1 point)
    10·2 answers
  • The lascaux cave paintings seem to indicate that there was an abundance of large game animals during prehistoric times true or f
    8·2 answers
  • In labrador retrievers, a common breed of dog, black coat is dominant to chocolate, normal vision is dominant to progressive ret
    13·1 answer
  • Although the brain's early development is in large part genetically directed, its structure is continually modified by environme
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • What is the purpose of the uninoculated control tubes used in the oxidation fermentation test? why is it necessary to use two co
    5·1 answer
  • Which feature do viruses have in common with animal cells
    9·1 answer
  • 4. The gravitational pull of Jupiter is greater than the gravitational pull of Earth. How
    14·1 answer
  • A
    8·1 answer
  • What unexpected result did Rutherford obtain in his gold-foil experiment?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!