1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
3 years ago
15

A subway car travels at a rate of 22 feet per second. How far does it travel in 11 seconds?

Mathematics
2 answers:
EastWind [94]3 years ago
5 0

Answer:

242 feet

Step-by-step explanation:

Thepotemich [5.8K]3 years ago
4 0
242 feet because 11 times 22 is 242
You might be interested in
As of the due date, your progress bar shows that you have completed 80% of a SmartBook assignment. After the assignment due date
inessss [21]

Answer:

80%

Step-by-step explanation:

The Score on the Connect reports show the level of complation of the SmartBook assignment till the due date.

Thus, the work done after the due date is not reflected in the Connect reports score.

Since you have completed 80% of the assignment <em>before</em> the due date, your score is 80%

4 0
3 years ago
Renting roller blades costs a flate fee of $5 plus an additional $2.50 per hour. Write a linear equation that models this.
Kobotan [32]

Answer:

Linear equation : y = 2.50h + 5

Step-by-step explanation:

Given that:

Fee for renting roller blades = $5

Per hour charges = $2.50

Let,

h be the number of hours roller blades were rented

y be the total amount

Total amount = Per hour charges * Number of hours + Flat fee

y = 2.50h + 5

Hence,

Linear equation : y = 2.50h + 5

4 0
3 years ago
What is the value of t
olchik [2.2K]

Answer:

t = 89°

Step-by-step explanation:

  • total interior angle of triangle is 180°

angle 1 is (t-46), angle 2 is (t), angle 3 is (180-(t+43))

summing them:

(t-46)+(t)+(180-(t+43)) = 180°

t -46 + t + 180 -t -43 = 180°

t + 91° = 180°

t = 180° - 91°

t = 89°

6 0
2 years ago
Please help I don't get this at all
Musya8 [376]
The first box is 9 and the one on the bottom is 36 and then 72
6 0
3 years ago
Can somebody help me please .
sineoko [7]

Answer:

The graph of the equation is given below.

Step-by-step explanation:

We are given the equation, -3x-4y=4

On simplifying, we get,

-3x-4y=4 i.e. 4y=-3x-4

So, the table is given by,

x                       4y=-3x-4                                       y

-4                     4y=-3\times (-4)-4 i.e. 4y=8             2

0                      4y=-3\times (0)-4 i.e. 4y=-4            -1

4                      4y=-3\times 4-4 i.e. 4y=-16             -4

Thus, the graph of the equation is given below.

5 0
3 years ago
Other questions:
  • 1+3+5+7+...+1003= what is the answer?
    8·2 answers
  • please help me with this geometry homework. Oh and also I'm looking for a tutor a couple days a week so if you know anyone messa
    15·1 answer
  • −x+4y when x=−45 and y=13
    12·2 answers
  • A group of 3 friends spends a total of $17.25 for brunch at a restaurant before tax and tip. Everyone orders the same thing: scr
    14·2 answers
  • based on the function F(x)=x^4-3x^2-1 and the graph of G(x) below, which of the following statements is true?
    10·1 answer
  • What is the difference of (3 • 1,000) – (2 • 100)
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What’s the distance between (8,-5 ) and (6,4)
    8·2 answers
  • Lincoln is preparing many gifts for a family holiday party. Each gift must either be
    13·1 answer
  • What is the rate in cups of lemon juice per cup of Greek yogurt ??
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!