Answer: Option B
Inductive reasoning.
Explanation:
It is inductive reasoning because inductive reasoning is a type of reasoning in which general informations are made based on some specific observations or information even when the conclusion is not complete guaranteed to be true.
This means that you make a guess's or generalizations based on the information you have at hand.
For example; The left handed people the you know uses left hand in right and you now make the conclusion that all left handed people write with their left hand only.
Answer:
d. Atrophy of the flexor digiti minimi.
Explanation:
The logical diangosis would be d. Atrophy of the flexor digiti minimi.
Flexor digiti minimi is a hypothenar muscle of that is used when we flex our little toe of the foot.Present at the metacarpophalangeal joint. When the foot is in anatomical position, it is lateral to the abductor digiti minimi. it is homologous to digiti minimi in the hands.
Hence, Atrophy of the flexor digiti minimi is necessary.
Answer:
Explanation:
The first one is Prostista: Since they are mostly unicellular and are classified as eukaryotic.
The second one is Eubacteria: Since all Eubacteria has peptidoglycan in their cell walls.
The Last One is Achaebacteria: They tend to help in digestion which is a very acidic environment and fit the other two criteria
The main function of tRNA is to __________________________.
The answer to this question is
<span>A-transfer amino acids to the site of protein synthesis </span>
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
