1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tomtit [17]
3 years ago
6

Does anyone know why electron affinity increases as going upward in the periodic table ​

Chemistry
1 answer:
kobusy [5.1K]3 years ago
6 0

Answer:

Electron affinity increases upward for the groups and from left to right across periods of a periodic table because the electrons added to energy levels become closer to the nucleus, thus a stronger attraction between the nucleus and its electrons.

You might be interested in
Please help me with dis
topjm [15]

Answer:

c

Explanation:

4 0
3 years ago
Regular table salt is sodium chloride, NaCl. It is a bonding of an Na+ ion and a Cl- ion. Which of these ions is bigger?
fenix001 [56]

Answer:

in the periodic table we can see that the ions of Cl is greater than the ions in Na

3 0
3 years ago
You are given a cube of pure copper when you calculate the density using
lara [203]

Answer:

2.01% to the nearest hundredth.

Explanation:

Percent error =[ (8.96-8.78) / 8.96]* 100

= 0.020089 * 100

= 2.0089 %

5 0
3 years ago
If 15.6 grams of copper (ii) chloride react with 20.2 grams of sodium nitrate how many grams of sodium chloride can be formed? W
olasank [31]

Answer:

- 13.56 g of sodium chloride are theoretically yielded.

- Limiting reactant is copper (II) chloride and excess reactant is sodium nitrate.

- 0.50 g of sodium nitrate remain when the reaction stops.

- 92.9 % is the percent yield.

Explanation:

Hello!

In this case, according to the question, it is possible to set up the following chemical reaction:

CuCl_2+2NaNO_3\rightarrow 2NaCl+Cu(NO_3)_2

Thus, we can first identify the limiting reactant by computing the yielded mass of sodium chloride, NaCl, by each reactant via stoichiometry:

m_{NaCl}^{by\ CuCl_2}=15.6gCuCl_2*\frac{1molCuCl_2}{134.45gCuCl_2} *\frac{2molNaCl}{1molCuCl_2} *\frac{58.44gNaCl}{1molNaCl} =13.56gNaCl\\\\m_{NaCl}^{by\ NaNO_3}=20.2gNaNO_3*\frac{1molNaNO_3}{84.99gNaNO_3} *\frac{2molNaCl}{2molNaNO_3} *\frac{58.44gNaCl}{1molNaCl} =13.89gNaCl

Thus, we infer that copper (II) chloride is the limiting reactant as it yields the fewest grams of sodium chloride product. Moreover the formed grams of this product are 13.56 g. Then, we take 13.56 g of sodium chloride to compute the consumed mass sodium nitrate as it is in excess:

m_{NaNO_3}^{by\ NaCl}=13.56gNaCl*\frac{1molNaCl}{58.44gNaCl}*\frac{2molNaNO_3}{2molNaCl} *\frac{84.99gNaNO_3}{1molNaNO_3}=19.72gNaNO_3

Therefore, the leftover of sodium nitrate is:

m_{NaNO_3}^{leftover}=20.2g-19.7g=0.5gNaNO_3

Finally, the percent yield is computed via:

Y=\frac{12.6g}{13.56g} *100\%\\\\Y=92.9\%

Best regards!

6 0
3 years ago
Which elements are in the same period?
worty [1.4K]

Answer:

Elements that are in the same period have chemical properties that are not all that similar. Consider the first two members of period 3: sodium (Na) and magnesium (Mg). In reactions, they both tend to lose electrons (after all, they are metals), but sodium loses one electron, while magnesium loses two.

Explanation:

(Hoped this helped! :D)

5 0
3 years ago
Other questions:
  • Determine which molecules are weak acids and weak bases, and place them in the appropriate category.
    14·1 answer
  • Given the reaction:
    9·1 answer
  • What do colligative properties depend on?
    10·2 answers
  • 5. Which of the following can be classified as a mixture ?
    12·1 answer
  • Which of the following statements about Avogadro’s Law is false? a. One mole of He occupies 22.4 L at STP. b. At constant P and
    13·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which level of organization describes the tropical savanna
    15·2 answers
  • How is wind energy more environmental friendly than heat energy?
    5·1 answer
  • Which terms describe plastics that can and potentially be recycled?
    7·1 answer
  • How many moles of CH3CH2Br are contained in 422 mL of 0.0950 M CH3CH2Br solution?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!