Answer:Oxygen
Explanation:
Oxygen gets reduced when iron is oxidized.
Answer:
Density of the He atom = 12.69 g/cm³
Explanation:
From the information given:
Since 1 mole of an atom = 6.022x 10²³ atoms)
1 atom of He = 
The volume can be determined as folows:
since the diameter of the He atom is approximately 0.10 nm
the radius of the He = 
= 0.05 nm
Converting it into cm, we have:
Assuming that it is a sphere, the volume of a sphere is
= 
= 
= 
Finally, the density can be calcuated by using the formula :
D = 12.69 g/cm³
Density of the He atom = 12.69 g/cm³
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Uses nuclear reactions to produce energy
Implodes a fuel pellet
Explanation:
Laser fusion is a method of initiating nuclear fusion reactions through heating, and compressing fuel pellets containing deuterium and tritium using high energy density laser beams. Lase fusion is also known as inertial confinement fusion and the energy produced by the process is known as Laser Inertial Fusion Energy, LIFE.
During the process of laser fusion, small pellets of deuterium-tritium (DT) isotopes mixture are fed into a blast chamber where they are compressed to high densities using a number of amplified laser beams in the chamber.
The high energy density of the beams as well as the heat produced due to compression, induces the thermonuclear explosion ignition resulting in the production of high energetic products such as charged particles, x-rays and neutrons. The energy produced is absorbed and stored as heat in a blanket that is then used in a steam thermal cycle to generate electrical power.
There are two methods of compression of the DT pellet: direct and indirect-drive laser fusions.
However, there are a number of limitations to energy production by this process. One limitation is that the process is extremely inefficient in energy energy production. Also, the heat produced by the flashtubes results innthe deformation of the laser glass.
Answer:
hjuijhbhjijnjnjghbgkjfgvv
Explanation:
