1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
15

What is the difference between a resource population and consumer population?

Biology
1 answer:
cricket20 [7]2 years ago
5 0

Answer:

Better known as the "predator-prey relationship," the consumer-resource relationship means the situation where a single species of organisms consumes for survival and reproduction.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
The energy stored in ATP is released when a_______is removed from the molcecule?
allsm [11]
When a phosphate group is removed from the molecule
6 0
3 years ago
What causes an ionic bond?
Keith_Richards [23]

Answer:

B

Explanation:

An ionic bond is formed when an atom usually metallic, loses an electron to become positively charged and another atom usually non-metallic, gains such electron lost and becomes negatively charged..

3 0
3 years ago
I WILL GIVE BRAINLY
spayn [35]

Answer:

Potts

Explanation:

3 0
2 years ago
Respiration involves the breakdown of sugar. This process results in the production of energy for the cell. In order for cells t
Lerok [7]
The answer is letter A. In most organisms cellular respiration usually involves oxygen to produce the most energy. Except in the process of fermentation, where the cells are deprived with oxygen causing it to form bacteria and other forms of organisms within the fermented sample.
8 0
3 years ago
Other questions:
  • Under what conditions does the heart rate change?
    7·2 answers
  • How do plants and sea life carbon in the carbon cycle?
    9·1 answer
  • The biotechnology developed for the forensic dna profiling process includes contributions from the sciences of _____.
    9·2 answers
  • As energy flows from producers to consumers, some E is lost to the<br> environment as
    7·1 answer
  • What would happen if there were no decomposers in a food web?
    15·2 answers
  • What causes variations in asexual organisms?
    6·1 answer
  • Which of the following is a biotic aspect of an organisms niche
    10·1 answer
  • Deforestation causes an increase in the atmospheric concentration of which greenhouse gas?
    9·2 answers
  • The secretion of aldosterone results in?...
    9·1 answer
  • Please help
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!