1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
13

1. Pink flowers are produced from crossing a flower with a red gene and a flower with a white gene. What

Biology
1 answer:
Rainbow [258]3 years ago
3 0

Answer:

Incomplete dominance

Explanation:

no allelic gene is dominant over the other..ie no gene masks thee other

You might be interested in
ASAP Please answer the questions in the images below. Thanks! Will give BRAINLIEST
allsm [11]

Answer:

first one is c and the second is d.

Explanation:

5 0
4 years ago
Listen
Inessa05 [86]

Answer:

A scientist's response to the increase in food poisoning sick patients should be examining the type and source within the foods consumed.

Explanation:

Food poisoning involves the effects that decomposed or contaminated food can have on a group of people who eat it, and can cause illness in all or most individuals.

Although patients' symptoms should be treated and preventive education provided, the best course of action for a scientist is to investigate the cause.

The response of a scientist to the increase in food poisoning cases is to determine the type and source of food, as well as the nature of the alteration it has -decomposition, contamination, bacteria- in order to <u>eliminate the source and avoid new cases</u>.

  • <em>The other options may be valid in the face of the appearance of food poisoning cases, but they are not the best procedure with which a scientist would respond. </em>
4 0
3 years ago
Classify each description as true of introns only, exons only, or both.A-present in eukaryotic genomesB-generally absent from ba
maxonik [38]

The right answers are:

A-present in eukaryotic genomes ==> Both exons and introns

B-generally absent from bacterial genomes ==> Introns

C-part of the final mRNA strand ==> Exons

D-code for an amino acid sequence ==> Exons

E-removed from initial mRNA strand prior to translation ==> Introns

F-present in the DNA used as the template for transcription ==> Both exons and introns

In the genes of eukaryotic organisms, the exons are the segments of an RNA precursor that are conserved in the RNA after splicing and that are found in mature RNA in the cytoplasm. The segments of the RNA precursor that are removed during splicing are called in opposition to introns. Exons are mainly found in messenger RNAs (mRNAs) encoding proteins. Some mRNAs may sometimes undergo an alternative splicing process in which one or more exons may be excised or some introns preserved in rare cases.

6 0
3 years ago
Addition of nutrients to Water by human activity is called​
wolverine [178]

A common way that humans pollute water is through the addition of nutrients (fertilizers and sewage) to water as nonpoint source pollution. These added materials are full of nitrogen and phosphorus, two nutrients that encourage the growth of aquatic producers, such as algae.

7 0
4 years ago
Humans affect the carbon cycle in many ways through the use of fossil fuels, clear cutting of forests, and controlled burns. Whi
LekaFEV [45]
I believe that the answer to this question is, that laws can be made to prevent certain things/ amounts of things to be used up.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Correct pronunciation of terms will not
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the scale length in centimeters from the beginning of the time period to the present on your scaled down geologic time s
    11·1 answer
  • How are prokaryotes who reproduce by asexual reproduction are NOT able to be very diverse in their genes?
    10·1 answer
  • How long do geoscience processes take to occur? plz help will give brainliest
    7·1 answer
  • What chemical in the nucleus regulates protein synthesis?
    10·1 answer
  • Saturated fats that are found in avocados are good and should not be limited.
    8·1 answer
  • Which type of extreme weather do you think is the most damaging: floods, hurricanes, tornadoes, tsunamis, or droughts? Why do yo
    14·2 answers
  • Should we clone animals that are going or have gone extinct (in other words bring them back
    9·2 answers
  • Many farmers are worried about the decreasing genetic diversity of plants associated with generations of artificial selection an
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!