1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
3 years ago
11

Is there anything i can do to help you bro?

Health
2 answers:
Damm [24]3 years ago
7 0

Answer:

Yeah man a couple things:

1 search up the predators of fawnfoot mussels

2 make sure you eat sum and drink water

3 have a nice day man

sveta [45]3 years ago
5 0
Not really life is sad but i appreciate the 5 points
You might be interested in
Mentally ill individuals who make the news are typical of those with mental illness.
ki77a [65]
True. The answer is in the sentence. If they say "mentally ill individuals who make the news..." then they are mentally ill, get it?
6 0
4 years ago
Compare a second grader's coordination with a third grader's.
Taya2010 [7]

Answer:

Second graders' fine motor skills often lag behind their gross motor skills, while third graders' fine motor skills are catching up.

Explanation:

Took the test and got it right hope this helps :D

8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
When a client suffers a complete pneumothorax, there is danger of a mediastinal shift. If such a shift occurs, what potential ef
guajiro [1.7K]

Answer:3: decreased filling of the right side of the heart

Explanation:

Pneumothorax occurs when the parietal or visceral pleura is breached or punctured, this leads to exposure of the pleural space to positive atmospheric pressure.

Normally, the pressure in the pleural space is negative compared to atmospheric pressure. This is required to maintain the inflation of lung. A breach to the pleura causes air to enter the pleural space thereby leading to lung collapse.

With an increased breath, there is an increase positive pressure in the pleural space, the air that entered the chest cavity is trapped and cannot be expelled. This leads to lung collapse and the heart, great vessels, and the trachea moves to the unaffected side(mediastinal shift).

The increased positive pressure decreases venous return to the heart (filling of the right side of the heart), causing decreased cardiac output and impairment of circulation round the body.

4 0
4 years ago
Need help ASAP!!
yaroslaw [1]
I think that its respect.
4 0
3 years ago
Other questions:
  • Write an I-message for the following scenario. Your boyfriend/girlfriend is constantly putting you down in front of your friends
    7·2 answers
  • Which is an example of gender expression?
    14·2 answers
  • Brent wants to know if his aerobic workout is the correct intensity.
    6·2 answers
  • In order to obtain energy what must animals do
    11·1 answer
  • Article writing on one must eat healthy food you are disturb that your friend are junk food edicts​
    6·1 answer
  • In this activity, you will be required to name three examples of traffic violations that you have either committed or witnessed.
    10·1 answer
  • What is a primary emotion?
    14·2 answers
  • The warm-up portion of a workout program is more important than the cool down portion. Please select the best answer from the ch
    11·2 answers
  • Please, help please!!!!!!!!!!!!!!!!!!!!!!
    13·1 answer
  • That's the most likely cause someone to develop eating disorder?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!