Active transport requires energy when moving molecules against a concentration agent. It requires for specific membrane transport proteins. Only a certain type of protein can move a certain type of substance.
The three main types of Active Transport are:
1) Sodium-Potassium Pump
2) Endocytosis
<span>3) Exocytosis </span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span>This is avoidance conditioning. Brenda has been able to successfully link the over-the-counter heartburn medicine to an avoidance of discomfort. By taking the pill, she has received a negative reinforcement due to the removal of the indigestion. The reinforcement will likely lead to Brenda continuing to take the medicine until she habituates to it and does not receive the same benefit(s).</span>
Answer:
How do punnet squares allow you to predict how traits are passed from one generation to the next?
This is simply achieved by crossing which enable each gene of both parents to be paired with one another
Explanation:
