1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
3 years ago
12

How are proteins constructed from amino acids?

Biology
1 answer:
Vika [28.1K]3 years ago
3 0
Amino acids are essentially the "building blocks" of proteins. You could think of it as an individual amino acid combining with others to form a link or stand.
You might be interested in
You have the following consumable items that you do not want spoiled by the action of microorganisms, but you have space in your
Llana [10]

Answer:

Bread Flavored syrup (contains water, high sugar concentration, flavors, e.g., used to flavor coffee and drinks)

Explanation:

Food spoilage refers to a situation in which food is no longer fit for consumption due to the action of certain microorganisms on the food. Hence, microorganisms cause the spoilage of food and beverages.

The rate of action of microorganisms on different beverages depends mostly on the content of the beverages.

Yeasts are often responsible for the spoilage of beverages with high sugar content and these tend to spoil faster than other beverages.

6 0
2 years ago
Serous membranes line certain cavities within the anterior body cavity. <br> a. true <br> b. false
crimeas [40]

Serous membranes line certain cavities within the anterior body cavity. This statement is FALSE.

Serous membrane, also known as serosa in anatomy, is a silky tissue membrane made of mesothelium that lines the interior of bodily cavities and their contents. It secretes serous fluid to permit greased sliding motions between friction surface. Organs housed in body cavities that don't open up to the outside are covered by serous membranes that line the body cavities. The epithelium secretes a thin coating of serous fluid that coats serous membranes.

An indication of a serous membrane is the lining of the thorax. The pleura is the name for the serous membrane found in the thorax. The visceral pleura, the innermost layer, is on the lungs, whereas the parietal pleura, the outermost layer, is on the interior layer of the thorax.

Learn more about Serous membrane

brainly.com/question/12993358

#SPJ4

7 0
2 years ago
Which line in the graph above best illustrates an effect of the carbon dioxide level in the blood on breathing rate before, duri
sukhopar [10]

The answer is; graph A

Breathing increases during exercise because the body is demanding more oxygen for the muscles. The hypothalamus detects the increased carbon dioxide in the blood dur9ng exercise and its commands the lungs to breath faster and deeper. When exercise stops, the body is restored to resting through homeostasis.


8 0
3 years ago
Read 2 more answers
Why it is essential for life to have material transported into and out of cells.
Yakvenalex [24]
So that the cell itself can maintain homeostasis and balance out its necessities
8 0
4 years ago
True-bred or pure-bred is the same as saying something is homozygous<br><br> True<br> False
Mazyrski [523]
TRUE. A true-breeding organism, sometimes also called a purebred, is an organism that always passes down certain phenotypic traits to its offspring.
3 0
3 years ago
Other questions:
  • In a food chain consisting of toxic soil, toxic grasses, rabbits that eat the toxic grass, and hawks that eat the rabbits, the h
    12·1 answer
  • In vertebrates, chemical messengers called hormones are secreted by the _____ system. endocrine excretory hormonal pituitary
    8·2 answers
  • One method of bioremediation is using plants to remove arsenic and radioactive uranium from soils.
    7·2 answers
  • When subjected to heat and pressure,a chemical sedimentary rock can be changed into which rock type?
    12·2 answers
  • What type of fault is formed when divergent plate move​
    6·1 answer
  • Describe the 4 types of neurotransmitters.
    5·1 answer
  • How do we get the glucose we need to power our cells? a. Breathing b. Exercising c. Eating d. Drinking water
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is involved in the Job of the Secretary of State?
    9·1 answer
  • What could be added to soil plot one to make the water drain and the soil more hospitable for growing plants
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!