1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
2 years ago
13

Which process contributes to the formation of layers in protoplanets when unstable elements release particles and energy?.

Biology
1 answer:
tamaranim1 [39]2 years ago
8 0

Answer:

c. radioactive decay

Explanation:

Radioactive decay refers to the natural breakdown of unstable elements or nucleus which lead to the release of energy or particles

And i got 100 on test

You might be interested in
The main result of photosynthesis is
Mazyrski [523]
Ha Ha, the answer will be... B!
6 0
3 years ago
Read 2 more answers
What is the principal of fossil succession?
Lostsunrise [7]
It basically means the oldest rocks and newest rocks are organized from top to bottom, like a bunk bed, oldest at the bottom, newest at the top in chronological order.
4 0
4 years ago
What happens to an ATP after it binds to the protein
lorasvet [3.4K]
It will become a manonamer organism
3 0
4 years ago
What does it mean when a word ends in -ose? (examples: Glucose,
Lyrx [107]
It is a carbohydrate
6 0
3 years ago
Read 2 more answers
Which muscle is the primary retractor from the protracted position of scapula?
Igoryamba
Serratus anterior would be the primary muscle. Correct me if I’m wrong.
6 0
4 years ago
Other questions:
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • In response to seasonal changes in temperature, many organisms must alter the composition of their plasma membranes to maintain
    12·1 answer
  • Scientific experiments must be able to be repeated by multiple scientists to verify the results that are obtained. Which of the
    5·2 answers
  • Answer this question properly​
    12·1 answer
  • Can somebody tell me if this is right or not.
    15·1 answer
  • X-rays carry a small risk of damaging DNA which can lead to cancer. Why are they still used by doctors?
    8·1 answer
  • Select the correct compound.
    10·1 answer
  • The statement, it is a matter of chance which homolog goes to which daughter cell best describes _____.
    14·1 answer
  • Is this right if not please tell me the right answer!
    13·1 answer
  • roposed that the 32P label was entering PE molecules by direct exchange (swapping phosphate groups with those found in solution)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!