1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Afina-wow [57]
3 years ago
8

You have two genes that control tongue rolling. How many did you get from mom and how many from dad?

Biology
1 answer:
o-na [289]3 years ago
3 0

Answer:

Imagine that to be able to roll your tongue you need two genes, A and B. For each of There is a certain dominant version for each of these genes that lets you roll your tongue.  cannot roll their tongue would have a tongue roller for a child. Another example is something called a modifier gene

You might be interested in
Name the renal process that occurs at the renal corpuscle.
schepotkina [342]
Answer: Filtration

Blood that is going to be filtered enters the first part of the nephron, the glomerulus, which is a tuft of capillary vessels. The glomerulus is inside a "sac" called a glomerular capsule.Together, the glomerulus and the glomerular capsule form the renal corpuscle, which is the filtering unit.
4 0
3 years ago
Place the steps for cloning the horse in the correct order. 1) Cloned horse born. 2) Collect tissue from dead horse. 3) Remove n
Naya [18.7K]

The order is 2,3,7,4,6,5,1

3 0
4 years ago
when plants are red flowers are crossed with plants with white flowers What proportion of The Offspring will have pink flowers
MakcuM [25]
The pink flower donates the r allele and produces pink flowers in 50% of the offspring. The genotype for the pink flower is Rr and the genotype for the white flower is rr. This would lead to a 50% chance of the offspring having a phenotype of pink.
8 0
3 years ago
DNA replication is used when body needs to
mafiozo [28]
<span>makes a copy of itself during cell division. </span>
4 0
3 years ago
What is happening to the DNA molecule in the figure?(Explain the first step in DNA replication)
Talja [164]

Answer:

As this is DNA replication, this is the unwinding process

Explanation:

In DNA replication, the parent DNA to be replicated is unwound to enable access of the replication machinery (replisome) to this genetic material. The origin of replication will be identified first, which in the prokaryotes is only one, and in the eukaryotes, we have many. This sites are recognized by specific sequences on the genome. after this, melting of the DNA occurs at this origin creating a replication bubble and two replication forks. This  allows for the unwinding of the DNA by the enzyme Helicases in the direction of the replication fork. Another enzyme present in this step is also the single strand binding proteins (SSB). These proteins function in the prevention of re-annealing of the unwound DNA strand by attaching themselves to each strands. Another enzyme called the topoisomerases also function here by reducing the torque (twisting) produced upstream of the replication fork as result of DNA unwinding. An example is the gyrase.

6 0
3 years ago
Other questions:
  • List some of the evidence for Continental Drift.
    15·1 answer
  • HIV's genome of RNA includes the code for reverse transcriptase (RT), an enzyme that acts early in infection to synthesize a DNA
    10·1 answer
  • Why is the equation not the equation of a line of best fit for the data set below?
    9·1 answer
  • On a field trip, a student in a marine biology class collects an organism that has differentiated organs, cell walls of cellulos
    5·1 answer
  • Discuss the concept of the null hypothesis and its use in data analysis.
    6·1 answer
  • What is a food web?
    13·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Will the utilization of GMOs cause ecological imbalance? why?​
    13·1 answer
  • Even in low doses, exposure to pesticide chemicals has not been linked to certain cancers, developmental health problems, and bi
    5·2 answers
  • What does a collar cell look like? What is its function?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!