1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Basile [38]
2 years ago
15

how does the content of the blood change when it leaves the right atrium and enters the right ventricle​

Biology
2 answers:
Nastasia [14]2 years ago
5 0
Blood first enters the heart's right atrium. A muscle contraction forces the blood through the tricuspid valve into the right ventricle. When the right ventricle contracts, blood is forced through the pulmonary semilunar valve into the pulmonary artery. Then it travels to the lungs
labwork [276]2 years ago
4 0
Blood first enters the heart's right atrium. A muscle contraction forces the blood through the tricuspid valve into the right ventricle. When the right ventricle contracts, blood is forced through the pulmonary semilunar valve into the pulmonary artery. Then it travels to the lungs.
You might be interested in
What contributed to the failed Mongol invasions of Japan?
Genrish500 [490]
The mongols underestimated the japanese military which then resulted badly.
4 0
2 years ago
Read 2 more answers
Hellpppppppppppppppppp
ziro4ka [17]

Answer:

It is biodiversity, I think. Not sure, though.

3 0
2 years ago
Name 11 organ systems
andre [41]

Answer:

integumentary, muscular, skeletal, nervous, circulatory, lymphatic, respiratory, endocrine, urinary/excretory, reproductive and digestive

Explanation:

Been doing this for a while

3 0
3 years ago
Fog generally develops around areas that are
mart [117]

Answer:The real answer is D

Explanation:

6 0
3 years ago
Read 2 more answers
which question to scientist need to asnwer to determine whether CRISPR can be used tofight a new bacterium that is resistant to
QveST [7]

Answer:

hiiurdfbjjjjkhdgyrfjpgtzy99f3w8

7 0
2 years ago
Read 2 more answers
Other questions:
  • A 198-lb patient is to receive a dobutamine infusion at 5 mcg/kg/minute. the label on the infusion bag states: dobutamine 250 mg
    8·1 answer
  • Scientists once debated how to classify the red panda. Today, how has analysis of the genome of the red panda provided evidence
    10·1 answer
  • In dogs, gum coloration is co-dominant, with black coloration,
    14·1 answer
  • Gases like oxygen and carbon dioxide move across cell membranes using______
    15·1 answer
  • Mary and Ron are discussing the properties of water. Mary says that when water freezes, it becomes less dense than liquid water.
    5·2 answers
  • Describe the experiments that revealed the structure of the genetic material. If a sample of DNA contains 8% adenine (A), then w
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Some bacteria live in the human digestive tract. Here bacteria finds a good environment to obtain nutrients. Humans improve the
    13·1 answer
  • Grasslands are biomes that are very valuable as areas for farming and grazing livestock. In
    11·2 answers
  • Need a friend.......
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!