1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
2 years ago
5

Please help me :(

Biology
1 answer:
Kobotan [32]2 years ago
3 0

Answer:

1. a.mutation,

b. recombination,

c. immigration of genes,

d.climate and

e.associations

2. Mutation : Is the changing of the structure of a gene, resulting in a variant form that may be transmitted to subsequent generations, caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes.

  • Gene flow : Gene flow is also called gene migration. Gene flow is the transfer of genetic material from one population to another. Gene flow can take place between two populations of the same species through migration, and is mediated by reproduction and vertical gene transfer from parent to offspring.

  • Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).

  • Genetic Recombination : Is a process by which pieces of DNA are broken and recombined to produce new combinations of alleles. This recombination process creates genetic diversity at the level of genes that reflects differences in the DNA sequences of different organisms.

3. The 3 Types of Natural Selection

  • Stabilizing Selection.
  • Directional Selection.
  • Disruptive Selection.

  • Stabilizing selection : Stabilizing selection is a type of natural selection in which the population mean stabilizes on a particular non-extreme trait value. This is thought to be the most common mechanism of action for natural selection because most traits do not appear to change drastically over time.

  • Directional Selection: In population genetics, directional selection, is a mode of negative natural selection in which an extreme phenotype is favored over other phenotypes, causing the allele frequency to shift over time in the direction of that phenotype.

  • Disruptive selection : Disruptive selection, also called diversifying selection, describes changes in population genetics in which extreme values for a trait are favored over intermediate values. In this case, the variance of the trait increases and the population is divided into two distinct groups.

You might be interested in
Which event occurs after erosion of Earth’s surface?
Fudgin [204]

Answer:

Very dense particles settle faster than low-density particles.

Explanation:

Erosion is the process of destroying and destroying existing forms in relief.

Erosion is the destruction of the existing structural connections of the rock mass due to the action of exogenous forces and the change of its shape.

The term erosion in the elementary sense should mean changes in the surface layer of the soil relief, which occur as a result of rain, snow, frost, temperature differences, wind, and running water, or due to the work of anthropogenic factors.

7 0
2 years ago
Read 2 more answers
Which best defines what matter is? anything that can be weighed anything that takes up space anything that can be weighed but do
Nikitich [7]
Matter is anything that takes up space.
4 0
3 years ago
A genetic factor for a trait is always expressed when it is present is best described as ?
zheka24 [161]

Answer:

A genetic factor for a trait that is always expressed when it is present is best described as dominant.

<u>OAmalOHopeO</u>

5 0
2 years ago
Part C Firefly luciferase is the enzyme that allows fireflies to illuminate their abdomens. Because this light generation is an
Bumek [7]

Answer:

K = 9.620 × 10⁻⁶

Explanation:

From the given information:

Temperature T= 6° C

= (273 + 6)K

= 279 K

The correct and well presentation of the reactions are:

1. Luciferin + O_2     ⇆     oxyluciferin + light   ΔG₁°

2. ATP                     ⇄   AMP + PP_i                  ΔG₂°  = -31.6 kJ/mol

The overall  ΔG° = -4.80 kJ/mol

Let's first determine the ΔG₁° for the equation (1)

ΔG° = ΔG₁° + ΔG₂°

- ΔG₁° = - ΔG° + ΔG₂°

ΔG₁° = ΔG° - ΔG₂°

ΔG₁° = ( -4.80 - (-31.6) ) kJ/mol

ΔG₁° = 26.8 kJ/mol

Using the formula:

ΔG° = -RTIn K

In \  K =\dfrac{-\Delta G^0}{RT} \\ \\ log \ K = -\dfrac{\Delta G^0}{2.303RT}

log \ K = -\dfrac{\Delta G_1^0}{2.303RT} \\ \\ log \ K = -\dfrac{26.8 \times 10^3 \ J/mol}{2.303\times 8.314 \ J/mol/K \times 279 \ K} \\ \\ log \  K =- 5.017

K = antilog (-5.017)

K = 9.620 × 10⁻⁶

6 0
2 years ago
Producers are able to:
mafiozo [28]
<span>D. take energy from the sun and make it usable for living things.
Producers are plants. Plants make energy from the sun through the process of photosynthesis and other living things (such as animals) eat the grass (known as grazing)
</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which is considered the foundation level of organization in an environment? community ecosystem organism population
    9·2 answers
  • Which of these events is an example of a primary disturbance in an ecosystem?
    13·2 answers
  • How many players make up a soccer team while they are playing on the field? Helppppp
    11·1 answer
  • The DNA isolated from a newly discovered virus is found to be 32 percent A, 18 percent C, 18 percent G, and 32 percent T. The ba
    9·1 answer
  • Role of mulluscus in soil
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Define the photosynthesis?​
    13·2 answers
  • Please help me with 7 and 8 it’s a test !!!!!!!!!
    12·2 answers
  • Please help me, its due today in the afternoon
    8·2 answers
  • Which of the following is a pyrimidine base in DNA?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!