1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nevsk [136]
2 years ago
7

Which of the following best explains the role of deep sea coral reefs in the environment? a. They are responsible for fouling fi

shing lines. B. They are a quick-growing food source for deep water predators. C. They provide a critical habitat for many other organisms. D. They are a record of past climate conditions. Please select the best answer from the choices provided A B C D.
Biology
1 answer:
Ugo [173]2 years ago
6 0

The role of deep-sea coral reefs in the environment is to provide critical habitat for many other organisms. So, the correct option is C.

<h3>What do you understand about Coral reefs?</h3>

A coral reef is an underwater ecosystem characterized by reef-building corals.

Coral reefs provide critical habitat for many invertebrates and fishes. These organisms are also known as cold-water corals, as they are found in the deeper and darker part of the ocean where the temperature is extremely low.

Therefore, the role of deep-sea coral reefs in the environment is to provide critical habitat for many other organisms.

To learn more about the Coral reefs, refer to the link:

brainly.com/question/364711

You might be interested in
Need an answer to #7<br> WILL MARK BRAINLIEST IF CORRECT
Sever21 [200]

Answer i think that B

Explanation:

6 0
3 years ago
Read 2 more answers
14 How does water form during cellular respiration?
Monica [59]

Answer:

Oxygen is reduced, gaining electrons and hydrogen ions. -second choice

8 0
3 years ago
Read 2 more answers
10. are a type of producer found in aquatic environments. In a particular lake, the phytoplankton have begun to
RUDIKE [14]

Answer: I think that it would be C because blooms are due to eutrophication, which means that there are high levels of phosphate in the water. Phosphate is a main ingredient in pesticides, which can run-off into rivers.

8 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
cupoosta [38]

Answer:

did you already get the answer or you still need help

4 0
2 years ago
Other questions:
  • Volcanic belts form along a. islands in the Pacific Ocean. b. North American mountain ranges. c. the boundaries of Earth’s plate
    9·2 answers
  • The Calvin cycle is considered light-independent because it can occur in darkness. However, most often the Calvin cycle takes pl
    7·1 answer
  • When Penguin Catering Services first opened, the owner decided to target only events at resorts in its geographic region. Pengui
    6·1 answer
  • Which of the following hormones stimulates pancreatic secretions?
    10·1 answer
  • What's an area of high pressure where air moves apart and sinks
    9·1 answer
  • This model shows the process of protein synthesis including transcription and translation. What is the best explanation for what
    9·1 answer
  • Hope you guys anwser fast!!!
    11·1 answer
  • What are some sources of nitrogen
    9·1 answer
  • What is the answer to this?
    6·1 answer
  • What would you need to do to your model to make it look like a true DNA molecule?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!