Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
<u>C) 4</u>
Explanation:
<u>The reaction</u> :
- C (s) + 2H₂ (g) ⇒ CH₄ (g)
12g 4g 16g
Hence, based on this we can say that : <u>2 moles of hydrogen gas are needed to produce 16g of methane.</u>
<u />
<u>For 32g of methane</u>
- Number of moles of H₂ = 32/16 × 2
- Number of moles of H₂ = <u>4</u>
Answer: The answer is an ionic bond
First, we construct the reaction equation:
Na₂SO₃ + 2HCl → 2NaCl + SO₂ + H₂O
H₂SO₃ is formed as an intermediate but decomposes to water and SO₂ gas.