1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
2 years ago
14

How is the energy that is carried in an ATP molecule released to provide usable energy?

Chemistry
2 answers:
Maslowich2 years ago
5 0

Answer:

The correct answer will be option-The bond holding the last phosphate group breaks.

Explanation:

Adenosine triphosphate or ATP is the energy molecule of the organism as it provides energy to the cell during the metabolic reaction.

The energy is stored in the phosphodiester bonds between the three phosphate molecules in the ATP molecule. The energy is released when the ATP molecule breaks down to ADP and AMP and the phosphate group is released from the molecule.

This release in the energy is used during the metabolic reactions and thus The bond holding the last phosphate group breaks is the correct answer.

Irina18 [472]2 years ago
3 0
The bond holding the last phosphate group breaks that is why <span> is the energy that is carried in an ATP molecule released to provide usable energy.</span>
You might be interested in
Determine if the chemical equation is balanced or not balanced. 1N2 + 1H2&gt; NH3 ​
almond37 [142]

Answer:

Explanation:

7 0
2 years ago
4. How does the kinetic theory of gases explain the weather changes happening in the troposphere? You can also research on the I
uranmaximum [27]
According to the kmt pressure is directly proportional to the number of collision between particles
4 0
3 years ago
Read 2 more answers
Write the ions present in a solution of K2CO3. Express your answers as chemical formulas separated by a comma. Offset subscripts
meriva

Answer:

K ^+ , CO3 ^2-

Explanation:

The compound is potassium trioxocarbonate(IV).

It contains cation (potassium ion) and acid radical ( trioxocarbonate (IV) ion).

Since K is in group 1 of the periodic table, it loses one electron to form ion i.e K^1. trioxocarbonate IV ion has a charge of 2-.and so the ions of the compound are as shown in the answer above.

8 0
2 years ago
28. Analyzing Results A pure white, solid material that
Dimas [21]

Answer:

a :Chemical  b : compound

Explanation:

a : it had to be a chemical change because it says "There is no change in

the appearance of the solid, but the reactivity of the material changes.

b : well it would be a compound because it would have to be to make a reaction

7 0
2 years ago
Replication, Transcription, and Translation Chart
NemiM [27]

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

6 0
2 years ago
Other questions:
  • The combustion of a sample butane, C4H10 (lighter fluid) produced 2.46 grams of water. how much oxygen was used up in grams
    15·1 answer
  • The human body can get energy by metabolizing proteins, carbohydrates or fatty acids, depending on the circumstances. Roughly sp
    15·1 answer
  • Mirrror metal and wood are the exaple
    11·1 answer
  • Chemical reactions occur when molecules or atoms collide so that the bonds between atoms break and new bonds form. breaking the
    9·1 answer
  • Why does hydrochloric acid have a higher boiling point than diatomic fluorine?
    9·1 answer
  • When a covalent bond forms between atoms, electrons are
    9·2 answers
  • The frequency of stretching vibrations is correlated to the strength and stiffness of the bond between two atoms. This can be th
    6·2 answers
  • Which of the following is an
    5·1 answer
  • What is the molarity of 6 moles of NaCI dissolved in 2 L of water
    11·1 answer
  • Ozone (O 3) is made of three atoms of oxygen. It is _
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!