1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
10

A sample of cacl2⋅2h2o/k2c2o4⋅h2o solid salt mixture is dissolved in ~150 ml de-ionized h2o. the oven dried precipitate has a ma

ss of 0.333 g. the limiting reactant in the salt mixture is k2c2o4⋅h2o. cacl2⋅2h2o(aq) + k2c2o4⋅h2o(aq) à cac2o4⋅h2o(s) + 2kcl(aq) + 2h2o(l) starting material (sm) product molar mass (mm) g/mol: cacl2⋅2h2o = 147.02 k2c2o4⋅h2o = 184.24 cac2o4 = 128.10 determine mass of k2c2o4⋅h2o(aq) in salt mixture in grams. answer to 3 places after the decimal and include unit, g
Chemistry
2 answers:
vagabundo [1.1K]3 years ago
5 0

<u>Answer:</u> The mass of K_2C_2O_4.H_2O in the salt mixture is 0.424 grams.

<u>Explanation:</u>

To calculate the number of moles, we use the equation:

\text{Number of moles}=\frac{\text{Given mass}}{\text{Molar mass}}      .....(1)

  • <u>For CaC_2O_4.H_2O :</u>

Given mass of CaC_2O_4.H_2O = 0.333 g

Molar mass of CaC_2O_4.H_2O = 146.12 g/mol

Putting values in equation 1, we get:

\text{Moles of}CaC_2O_4.H_2O=\frac{0.333g}{146.12g/mol}=0.0023mol

The given chemical equation follows:

CaCl_2.2H_2O(aq.)+K_2C_2O_4.H_2O(aq.)\rightarrow CaC_2O_4.H_2O(s)+2KCl(aq.)+2H_2O(l)

By Stoichiometry of the reaction:

1 mole of CaC_2O_4.H_2O is produced by 1 mole of K_2C_2O_4.H_2O

So, 0.0023 moles of CaC_2O_4.H_2O will be produced by = \frac{1}{1}\times 0.0023=0.0023mol of K_2C_2O_4.H_2O

Now, calculating the mass of K_2C_2O_4.H_2O by using equation 1, we get:

Molar mass of K_2C_2O_4.H_2O = 184.24 g/mol

Moles of K_2C_2O_4.H_2O = 0.0023 moles

Putting values in equation 1, we get:

0.0023mol=\frac{\text{Mass of }K_2C_2O_4.H_2O}{184.24g/mol}\\\\\text{Mass of }K_2C_2O_4.H_2O=(0.0023mol\times 184.24g/mol)=0.424g

Hence, the mass of K_2C_2O_4.H_2O in the salt mixture is 0.424 grams.

Paraphin [41]3 years ago
3 0

We are given that the balanced chemical reaction is:

cacl2⋅2h2o(aq) + k2c2o4⋅h2o(aq) ---> cac2o4⋅h2o(s) + 2kcl(aq) + 2h2o(l)

We known that the product was oven dried, therefore the mass of 0.333 g pertains only to that of the substance cac2o4⋅h2o(s). So what we will do first is to convert this into moles by dividing the mass with the molar mass. The molar mass of cac2o4⋅h2o(s) is molar mass of cac2o4 plus the molar mass of h2o.

molar mass cac2o4⋅h2o(s) = 128.10 + 18 = 146.10 g /mole

moles cac2o4⋅h2o(s) = 0.333 / 146.10 = 2.28 x 10^-3 moles

Looking at the balanced chemical reaction, the ratio of cac2o4⋅h2o(s) and k2c2o4⋅h2o(aq) is 1:1, therefore:

moles k2c2o4⋅h2o(aq) = 2.28 x 10^-3 moles

Converting this to mass:

mass k2c2o4⋅h2o(aq) = 2.28 x 10^-3 moles (184.24 g /mol) = 0.419931006 g

 

Therefore:

The mass of k2c2o4⋅<span>h2o(aq) in the salt mixture is about 0.420 g</span>

You might be interested in
4 outer planets in order
Gwar [14]
Jupiter, Saturn, Uranus, Neptune, Jovian... is your answer. 
8 0
3 years ago
Read 2 more answers
How many grams are equivalent to 1.80x10-4 tons?
zloy xaker [14]
Do you want the estimated answer or the exact answer?

6 0
3 years ago
Draw the product formed when cyclohexene is reacted with H2 in the presence of Pt. Note: If adding hydrogen atoms to a carbon at
tigry1 [53]

Answer:

It has been drawn and uploaded as an attachment. Please download it to see the structure.

Explanation:

The product formed as a result of the reaction of cyclohexene with H2​ in presence of Pt (platinum) can be described as catalytic hydrogenation. Catalytic hydrogenation is defined as the process of hydrogen addition in the presence of a catalyst, which in this case is platinum.

Note that Cyclohexene (alkene) is a hydrocarbon molecule represented by the chemical formula, C6​H10​ .

It consists of a double bond. During the hydrogenation reaction, the alkene undergoes an addition reaction to give alkane which is a saturated hydrocarbon as the product.

The first step in order to derive the product is to draw the chemical structure of cyclohexene and identify the double bond present in it.

The final product can be derived by replacing the double bond with the single bond and satisfying all the valences of the carbon atom. The final product structure has been drawn and uploaded as an attachment. Please download it to see the structure.

Ans:

The structure of the cyclohexane thus, formed has been shown as follows with all the hydrogen atoms:

3 0
3 years ago
How many liters are equivalent to 43 milliliters?
marysya [2.9K]

Answer:

The answer is B) 0.043 L

Explanation:

Hope this helps :))

8 0
3 years ago
Read 2 more answers
Which one of the following formulas represents an aldehyde? 
Masteriza [31]
The formula of Aldehyde is represented by <span>C2H4O. It has two atoms of Carbon, four atoms of hydrogen and one atom of oxygen. Aldehyde is an organic compound. It's organic because it contains carbon. It has a structure of R-CHO, that consists a carbonyl center bonded to R group and to hydrogen.</span>
8 0
3 years ago
Other questions:
  • What test or tests do you use to find NaCl
    12·2 answers
  • The sodium content of twenty 300-gram boxes of organic cornflakes was determined. The data (in milligrams) are as follows: 131.1
    11·1 answer
  • Kinetic energy <br><br>definition:<br><br><br>sentence: ​
    6·1 answer
  • Pls I need
    11·1 answer
  • Solid calcium hydroxide is dissolved in water until the pH of the solution is 10.44. Determine the concentration of the calcium
    10·1 answer
  • What is the chemical equation for F2 + At- --&gt;
    10·1 answer
  • Molecules in the gas phase move faster than the same molecules love in the liquid true or false
    15·2 answers
  • Pleaseeeeeeeeeee helpppppppppppppppp
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Compute the value of the molar heat capacity at constant volume, CVCV, for CO2CO2 on the assumption that there is no vibrational
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!