This equation C5H + O2 ---> CO2 + H2O has a mistake.
C5H is wrong. You missed the subscript of H.
I will do it for you assuming some subscript to show you the procedure, but you have to use the right equation to get the right balanced equation.
Assuming the tha combustion equation is C5H12 + O2 ---> CO2 + H2O
First you need to balance C, so you put a 5 before CO2 and get
C5H12 + O2 ---> 5CO2 + H2O
Now you count the hydrogens: 12 on the left and 2 on the right. So put a 6 before H2O and get:
C5H12 + O2 ---> 5CO2 + 6H2O
Now count the oxygens: 2 on the left and 16 on the right, so put an 8 on before O2:
=> C5H12 + 8O2 ---> 5CO2 + 6H2O.
You can verify that the equation is balanced
Unit Cell is the basic <span>repeating structural unit of a crystalline solid .</span>
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
This approximation of mass can be used to easily calculate how many neutrons an element has by simply subtracting the number of protons from the mass number. Protons and neutrons both weigh about one atomic mass unit or amu. Isotopes of the same element will have the same atomic number but different mass numbers.
Explanation:
Answer:
yes answer os Na because it's electronic configuration is 1s^2,2s^2,2p^6,3s^1
