1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
2 years ago
15

A gem has a mass of 5. 50 g. When the gem is placed in a graduated cylinder containing 9. 500 ml of water, the water level rises

to 10. 45 ml
Chemistry
1 answer:
Katena32 [7]2 years ago
6 0

The density in grams per milliliter  7.975.

<h3>What is density?</h3>

Density is the mass of per unit volume. Density is equals to mass into volume.

D = M x V

The mass of a gem is given, M = 5.50

The volume is 10.45 - 9.00 = 1.45

Thus, the density is

D = 5.50 × 1.45 = 7.975

Thus, the density in grams per milliliter is 7.975.

Learn more about density

brainly.com/question/19320982

#SPJ4

You might be interested in
Need help balancing these ​
kari74 [83]
The answer would be 1,3,1,3
3 0
3 years ago
Read 2 more answers
1 mol super cooled liquid water transformed to solid ice at -10 oC under 1 atm pressure.
Arada [10]

Answer:

Explanation:

Given that:

number of moles of super cooled liquid water = 1

Melting enthalpy of ice = 6020 J/mol

Freezing point =0 °C = (0 + 273 K)= 273 K

The decrease in entropy of the system during freezing for 1 mol (i.e during transformation from liquid water to solid ice )  = - 6020 J/mol × 1 mol /273 K = -22.051 J/K

Entropy change during further cooling from 0 °C (273 K) to -10 °C (263 K)

\Delta \ S = \int\limits^{T_2}_{T_1}\dfrac{nC_p(s)dT}{T}

\Delta \ S = {nC_p(s)In \dfrac{T_2}{T_1}

\Delta \ S = {(1*37.7)In \dfrac{263}{273}

Δ S = -1.4 J/K

Total entropy change of the system = - 22.05 J/K - 1.4 J/K = - 23.45 J/K

Entropy change of universe = entropy change of the system+ entropy change of the surrounding

According to the second law of thermodynamics

Entropy change of universe  >0

SO,

Entropy change of the system + entropy change in the surrounding > 0

Entropy change in the surrounding > - entropy change of the system

Entropy change in the surrounding > - (- 23.53 J/K)

Entropy change in the surrounding > 23.53 J/K

b) Make some comments on entropy changes from the obtained data.

From the data obtained; we will realize that the entropy of the system decreases as cooling takes place when water is be convert to ice , randomness of these molecules reduces and as cooling proceeds , hence, entropy reduces more as well and the liberated heat will go into the surrounding due to this entropy of the surrounding increasing.

4 0
3 years ago
How do plants affect the amount of carbon in Earth’s atmosphere?
kaheart [24]

Answer:

c

Explanation:

plants decrease the levels of carbon dioxide in the atmosphere due to the process of photosynthesis

6 0
2 years ago
Which particle is emitted when an atom of 85Kr spontaneously decays?
stiv31 [10]
A Beta particles is emitted when an atom of 85Kr spontaneously decays.
5 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • When 8.5 g of methane (ch4) is burned in a bomb calorimeter (heat capacity = 2.677 × 103 j/°c), the temperature rises from 24.00
    7·2 answers
  • A metallic material that is made by uniformly mixing copper with zinc to form bronze.
    9·1 answer
  • Hydrogen atoms in a discharge tube are in their ground state. If a beam of free electrons of energy12.9 eV are fired at the hydr
    15·1 answer
  • Standard reduction potentials are based on which element?
    5·1 answer
  • Which one below will can cause the reaction rate to increase?
    15·1 answer
  • What element is used as a shield to protect from radioactive substances?
    13·1 answer
  • Which of the answer choices correctly describes Le Châtlier's principle?
    5·2 answers
  • The law of conversation of mass states that the mass of the reactant is ___ the mass of products
    8·1 answer
  • Relation between glancing and angle of deviation<br>​
    5·1 answer
  • WILL GIVE BRAINLEST!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!