1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vsevolod [243]
1 year ago
15

How to convert °c 40 to °f

Chemistry
1 answer:
olasank [31]1 year ago
4 0

Answer:

104 f

Explanation:

multiply 40 by 1.8 and then add 32

You might be interested in
thank you so much for helping me I don't know science that well trying to get better I've been getting better good grades but st
Rasek [7]

there is not enough information to make a prediction as we dont know what side she taped on magnet C

5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
In the molecular orbital model of cyclobutadiene, how many -antibonding molecular orbitals are there?
Citrus2011 [14]

There are one antibonding molecular orbitals present in molecular orbital model of c.

The cyclobutadiene has a pi system comprised of four  individual atomic p - orbital and thus should have a four pi   molecular orbitals. The compound is the prototypical antiaromatic hydrocarbon with 4 \pi - electrons .  Its rectangular structure is the result of jahn teller reaction which disorder the molecule and lowers its symmetry , converting the triplet to a singlet ground state. It is a small annulene . The  delocalisation energy of the  \pi   electrons of the cyclobutene is predicted to be zero .

To learn more about antibonding molecular orbitals click here

brainly.com/question/14970060

#SPJ4

4 0
2 years ago
A metal pellet with a mass of 100.0 g, originally at 116°C, is dropped into a cup of water, initially at
Alina [70]

Answer:

C, 42g

Explanation:

In thermal equilibrium, both bodies (metal pellet and water) both have the same final temperature (46.3°C).

Assuming no heat is lost to surroundings,

the energy lost from metal pellet = energy gained for water

Since E = mc∆T

(energy = mass x specific heat capacity x temperature change)

mc∆T (metal pellet) = mc∆T (water)

100 x 0.568 x (116-46.3) = m 4.184 (46.3 - 23.8)

3958.96 = 94.14m

m = 42g

6 0
2 years ago
Gas is heated from 480. K to 750. K and the pressure is kept constant, what final volume would result if the original volume was
attashe74 [19]
Charles law gives the relationship between volume and temperature of gas.
It states that at constant pressure volume is directly proportional to temperature
Therefore
V/ T = k
Where V - volume T - temperature in kelvin and k - constant
V1/T1 = V2/T2
Parameters for the first instance are on the left side and parameters for the second instance are on the right side of the equation
Substituting the values in the equation
267 L/ 480 K = V / 750 K
V = 417 L
Final volume is 417 L
8 0
3 years ago
Other questions:
  • The primary function of the _______________ is to store and concentrate bile from the liver.
    7·2 answers
  • A zircon mineral is found in the North Cascades and used to date the age of the mountains. The sample is treated and the relativ
    8·1 answer
  • Potassium nitrate, KNO3, decomposes to form potassium nitrite, KNO2, and oxygen gas, O2. Write the balanced equation for this de
    8·2 answers
  • As you move down a group, you will recall that the radius increases. Why do you think an increase in atomic radius would result
    7·1 answer
  • Please anyone help please I will pray for you
    15·1 answer
  • Yo momma a BlXLXLTCH !<br><br> kyxs so hard where u drai
    13·1 answer
  • Is there a polyatomic ion in calcium phosphide ?
    15·1 answer
  • 1. For each of the following formulas:
    6·1 answer
  • The heaviest known alkaline earth metal is radium, atomic number 88.
    10·1 answer
  • Provide the correct IUPAC name for Sr(OH)2 - 7H20.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!