1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
2 years ago
9

A family released their pet fish family into a local pond. The fish had no known local population. The impact of the fish on the

ecosystem is not yet known.
Which term would best define the fish added to the pond?
Biology
1 answer:
nirvana33 [79]2 years ago
3 0

The term that would best define the fish added to the pond is introduced species.

<h3>What is introduction of a species?</h3>

Adaptation to the conditions of the place in which it was inserted, the absence of predators and degradation are the main factors that lead an exotic species to become invasive, competing with native species for resources and causing a great impact on the community.

In this case, the introduced species are exotic species which has arrived there by human activity, may even be harmful to the entire ecosystem because they can break the delicate equilibrium of the ecosystem.

See more about introduced species at brainly.com/question/21452505

#SPJ1

You might be interested in
Which best describes the scientists who contributed to our current body of
olya-2409 [2.1K]

Answer:B

Explanation:

6 0
3 years ago
Read 2 more answers
2 points<br> Individuals that are well adapted to their environment will survive and<br> produce
Novosadov [1.4K]

Answer:

Individuals that are well adapted to their environment will survive and reproduce

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

3 0
3 years ago
What is required for sexual reproduction to occur?
Dimas [21]

Answer:

a d*ck and a yk what-

Explanation:

no need for me to say more,

3 1
3 years ago
Read 2 more answers
When the number of organisms increases in an ecosystem, the
Fudgin [204]
I believe B) I think because if there are more animals nothing is going to change but the supplys like food and shelter may decrease but that's not an option
7 0
3 years ago
Read 2 more answers
Humans ferment _______ in muscles where oxygen becomes depleted
Scilla [17]
Humans ferment ___carbon dioxide___ in muscles where oxygen becomes depleted
6 0
3 years ago
Read 2 more answers
Other questions:
  • Can you tell me what is a lotus?
    9·1 answer
  • Which would be the producer in a food chain?
    14·2 answers
  • Which is a characteristic of exponential population growth?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • We inhale O₂ and we exhale CO₂. Carbon dioxide is produced __________. a. in the reaction that creates acetyl CoA (coenzyme A) b
    13·1 answer
  • Involves the transfer of genetic material from one bacteria to another.
    13·1 answer
  • What reaction is likely to be initiated by the catalase enzyme?the
    15·1 answer
  • What are two kinds of fermination?
    10·1 answer
  • Assume that three loci, each with two alleles (A and a, B and b, C and c), determine the differences in height between two homoz
    7·2 answers
  • Por qué algunas enfermedades se padecen solo una vez?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!