Answer:
i cant see the whats in the picture
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
<span>FeNCS+ product...............thats how you do it i believe </span>
Answer : The change in entropy is 
Explanation :
Formula used :

where,
= change in entropy = ?
m = mass of water = 1.00 kg
= heat of vaporization of water = 
T = temperature = 
Now put all the given values in the above formula, we get:


Therefore, the change in entropy is 
Answer:
amount of silver chloride required is 0.015 moles or 2.1504 g
Explanation:
0.1M AgCL means 0.1mol/dm³ or 0.1mol/L
1L = 1000mL
if 0.1mol of AgCl is contained in 1000mL of solution
then x will be contained in 150mL of solution
cross multiply to find x
x = (0.1*150)/1000
x= 0.015 moles
moles of silver chloride present in 150 mL of solution is 0.15 moles
To convert this to grams, simply multiply this value by the molar mass of silver chloride
molar mass of silver chloride AgCl =107.86 + 35.5
=143.36 g/mol
mass of AgCl = moles *molar mass
=0.015*143.36
=2.1504g
=