1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FromTheMoon [43]
2 years ago
12

an acid accepts H and removes them from a solution, is a solution where the water molecules are intact

Chemistry
1 answer:
n200080 [17]2 years ago
8 0
<h3>An acid accepts H and removes them from a solution</h3>

When placed in water, acids, bases, and salts dissociate (separate) into electrolytes (ions). Salts dissociate into a cation (that is not H+) and an anion (that is not OH-), whereas acids and bases dissociate into H+ and an anion. An acid separates into anions and hydrogen ions (H+). Strong acids produce a high concentration of H+ by dissociating every single one of their molecules . Water-based solutions,

Acid:

When a material or chemical is in solution, it releases hydrogen ions (H+), which are known as acids. All hydrogen ions (H+) and chloride ions (Cl-), which are normally bound together by ionic bonding, dissociate (separate) in water when exposed to a strong acid like hydrochloric acid (HCl). Only some ions disintegrate into hydrogen ions (H+) and bicarbonate ions (HCO3-) in a weak acid like carbonic acid (H2CO3), while others are still bound together by ionic bonds.

Define base?

A base is a chemical that, when in solution, emits hydroxyl ions -{OH). We can also define a base as a substance that releases hydroxyl ions (OH-), which mix with any hydrogen ions (H+) in the solution to generate water molecules (OH- + H+ = H2O).

Therefore, a substance that receives or accepts hydrogen ions (H+) that are already present in the solution qualifies as a base.

Because it totally dissociates into sodium ions (Na+) and hydroxyl ions (OH-) when placed in water, sodium hydroxide (NaOH), which is a strong base, is now liberated and dissolves in water.

c

for more information please visite:

brainly.com/question/15017356?referrer=search

#SPJ4

You might be interested in
Why is Potassium not used in school laboratory
densk [106]
<h3>Because it is harmful for school environment.</h3>

Potassium Metal Is Explosive— Do Not Use It! The reaction of sodium with water is a spectacular and essential classroom demonstration. Many teachers want to show also the more violent reaction of potassium. We propose not to do so because explosions can happen even before the metal is in contact with water.

<em>-</em><em> </em><em>BRAINLIEST</em><em> answerer</em>

6 0
3 years ago
Read 2 more answers
What does the average atomic mass on the periodic table tell you?
never [62]
The atomic mass on the periodic table represents the sum of number of protons and number of neutrons.

Atomic mass = Number of protons + number of neutrons

Hope this helps!
3 0
3 years ago
Nickel is extracted from nickel oxide by reduction with carbon.
meriva

Answer:

Nickel is extracted from nickel oxide by reduction with carbon. Nickel is a metal which react with atmospheric oxygen which is very reactive in order to protect the inner surface of metal. Carbon extract oxygen which is attached to the nickel in the form of nickel oxide because carbon is more reactive so it made a chemical bonds with oxygen and nickel oxide is converted into a pure nickel.

3 0
3 years ago
Why do water molecules and the materials dissolved in water move through the plasma membrane slowly ?
garik1379 [7]

Nonpolar and small polar molecules can pass through the cell membrane, so they diffuse across it in response to concentration gradients. Carbon dioxide and oxygen are two molecules that undergo this simple diffusion through the membrane. The simple diffusion of water is known as osmosis.

4 0
4 years ago
HELP ASAP PLEASE!!!
Dmitry [639]

Answer:

A. Electrolyte

Explanation:

Concentrated sulfuric acid has a density of 1.84 g/millimeter. When you dilute this with water to 5.20 M, you then have a density of 1.30 g/millimeter, which then can be used as a lead storage for batteries in automobiles. (Got help to answer this at Www.wyzant.com

3 0
3 years ago
Other questions:
  • The same baseball is thrown two different times The second throw is faster than the first throw.Which has more kinetic energy?
    6·1 answer
  • An aqueous solution of iron(II) sulfate (FeSO4) is prepared by dissolving 2.00 g in sufficient deionized water to form a 200.00
    12·1 answer
  • Who were the scientists who won the nobel prize for the atomic model?
    12·1 answer
  • Explain why water has a higher boiling point than carbon iv oxide and the two are simple molecular structures
    10·1 answer
  • What is the concentration of H+ ions at a pH = 2?
    11·1 answer
  • If 15 L of chlorine reacts at a constant temperature of 298 K and pressure of 9 atm, how many grams of hydrochloric acid (HCl) a
    9·1 answer
  • 4Fe+3O2--&gt;2Fe2O3. How many moles of fe2o3 are produced from 0.5 moles of o2?
    11·1 answer
  • Where on the pH scale would you find acids? Bases? What is unique about a pH of 7?
    14·2 answers
  • 1.How many moles of each element are in 0.0250 mol of K 2 Cr O 4?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!