1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lys-0071 [83]
2 years ago
11

How many significant figures are in this number? 43.55

Chemistry
1 answer:
leva [86]2 years ago
7 0

Answer:

4 significant figures

Explanation:

Significant figures are the units/digits within a number that make the number more accurate and precise.

All digits (except for 0) are always significant. Therefore, all the digits in 43.55 are significant. Since there are 4 digits in the given number, there are 4 significant figures.

You might be interested in
What's the difference between a conductor and an insulator?<br><br>I'll mark you as brainliest ​
irina [24]

conductor are defined as the materials or substances that allow electricity to flow through them. Also, conductors allow heat to be transmitted through them. Examples of conductors are metals, the human body, Earth and animals. The human body is a strong conductor.

Any material that keeps energy such as electricity, heat, or cold from easily transferring through is an insulator. Wood, plastic, rubber, and glass are good <em><u>insulator</u></em><em><u>.</u></em>

Explanation:

have a beautiful day

8 0
2 years ago
Read 2 more answers
Use Hess law and the following equations to calculate H for the reactio below
aleksandr82 [10.1K]

Answer: B2H6 (g) + 3O2 (g) → B2O3 (s) + 3H2O (g) (ΔH = -2035 kJ/mol) 3H2O (g) → 3H2O (l) (ΔH = -132 kJ/mol) 3H2O (l) → 3H2 (g) + (3/2) O2 (g) (ΔH = 858 kJ/mol)

Explanation: ??

8 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
19 The coefficients in a balanced chemical equation represent(l ) the mass ratios of the substances in the reaction(2) the mole
Andrews [41]
2. The coefficients represent to molar ratios in a balanced equation.
8 0
3 years ago
Boron has primarily two isotopes, one with an atomic mass of 11.0 amu and another with an atomic mass of 10.0 amu. If the abunda
Masja [62]

Answer:

The atomic mass of the boron atom would be <em>10.135</em>

Explanation:

This is generally known as relative atomic mass.

Relative atomic mass or atomic weight is a physical quantity defined as the ratio of the average mass of atoms of a chemical element in a given sample to the atomic mass of 1/12 of the mass of a carbon-12 atom. Since both quantities in the ratio are masses, the resulting value is dimensionless; hence the value is said to be relative and does not have a unit.

<em>Note that the relative atomic mass of atoms is not always a whole number because of it being isotopic in nature.</em>

  • <em>Divide each abundance by 100 then multiply by atomic mass</em>
  • <em>Do that for each isotope, then add the two result. Thus</em>

Relative atomic mass of Boron = (18.5/100 x 11) + (81/100 x 10)

                                                 = 2.035 + 8.1

                                                 = 10.135

5 0
3 years ago
Other questions:
  • elect the correct answer. The elements beryllium, calcium, and strontium are all in group 2. What is the correct relationship of
    12·1 answer
  • In order to complete a lab, your teacher needs a 3.0 M solution of sulfuric acid, but only has a 12.0 M stock solution of sulfur
    14·1 answer
  • Would the boiling point of water at 0.5 atm be lower, the same, or higher than the
    5·1 answer
  • Hydrogen is a special ,because it can act like two groups,____and_____
    9·1 answer
  • a 1kg rock is at a height of 100 meters. What is the rocks gravitational potential energy at 100 meters high
    6·2 answers
  • Calcium carbonate reacts with hydrochloric acid to form calcium chloride, carbon dioxide, and water. What mass of hydrochloric a
    10·1 answer
  • Write the balanced chemical equation for lab preparation of oxygen gas by using heat​
    8·2 answers
  • Something that is bizarre fact about Radon that unique and relatively unknown by the general population??
    14·1 answer
  • A red line is observed at 656.3 nm in the spectrum of atomic hydrogen. determine the values of ???? for the beginning and ending
    14·1 answer
  • equal volumes of equimolar aqueous solutions of sodium sulfite and hydroiodic acid are mixed. what net ionic equation describes
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!