1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
1 year ago
13

orbital cellulitis 5462 children included for study, 1347 (24%) were prescribed corticosteroids within 2 days of admission

Chemistry
1 answer:
son4ous [18]1 year ago
4 0

It's unable to identify a decrease in LOS linked to corticosteroid exposure during hospitalization for ocular cellulitis in this database search. After two days of hospitalization, operational episodes and the prescription of corticosteroids were related to admission to the PICU.

Within two days of admission, 1347 (24%) of the 5462 children who were included in the research received a corticosteroid prescription. In analyses that controlled for age, the existence of meningitis, abscess, or visual problems, as well as the surgical episode and PICU admission within 2 days, corticosteroid prescription was not linked with LOS (e = 1.01, 95% confidence interval [CI]: 0.97-1.06). Among patients with a primary diagnosis of orbital cellulitis, corticosteroid exposure was linked to surgical events after two days of hospitalization (odds ratio = 2.05, 95% CI: 1.29-3.27) and 30-day readmission (odds ratio = 2.40, 95% CI: 1.52-3.78). Prospective, randomized control trials are required prior to the widespread usage of corticosteroids.

Learn more about orbital cellulitis here:-

brainly.com/question/15572218

#SPJ4

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
In the Energy and Specific Heat lab, what temperature should be recorded as the final temperature of the water when measuring th
Anon25 [30]

Answer:

B. The temperature of the water when the food sample has finished burning completely.

Explanation:

Heat or thermal energy is a form of energy that transfers from one object to another due to a temperature difference between the objects. The units for heat are joules or calories.

Calorimetry is the measurement of heat energy released or absorbed in a chemical  reaction. A calorimeter is used in calorimetry. The calorimeter operates on the Law of Conservation of Energy which states that energy is never created or destroyed but is transformed from one form to another or between objects.

In food calorimetry, the energy released when food is burned is measured by recording the rise in temperature of water in a calorimeter when a given mass of a food sample is burned completely.

Energy can be calculated using the formula: Q = mc ∆T

where Q = the energy in joules or calories, m = the mass in grams, c = specific heat and ∆T = the change in temperature (final temperature - initial temperature).

The temperature of the water when the food sample has finished burning completely is taken as the final temperature of the water. The sample is allowed to smolder for sometime before recording the final  water temperature. This is because the water temperature will continue to rise after the  flame has gone out.

6 0
3 years ago
How many moles of magnesium are in 3. 01 x 10^22 atoms of magnesium.
marshall27 [118]

Answer:

Explanation:

1 mol of anything is 6.02 * 10^23 atoms (in this case)

x mol of 3.01 * 10^22

Set up the proportion

1/x = 6.02*10^23 / 3.01 * 10^22                 Cross multiply

x*6.02 * 10^23 = 1 * 3.01 * 10^22               Divide by 6.02*10^23

x = 3.01 * 10^22 / 6.02*10^23

x = 1/(2 * 10)

x = 1/20 mol

x = 0.05 mol

5 0
2 years ago
Which type of property can be observed only by changing a substance into a different substance? A. intensive property B. extensi
Scorpion4ik [409]

The answer would be D because a chemical property is Burning is a chemical property and a chemical property is any of material's properties that becomes evident during or after a chemical reaction that is any quality that can be established only by changing a substance's chemical identity.

i hope i helped you out and i hope you did great and i am sorry if i am too late

3 0
3 years ago
Read 2 more answers
What is the type of compound of copper and oxide?
kykrilka [37]
Copper<span>(II) </span>oxide<span> or cupric </span>oxide<span> is the inorganic </span>compound<span> with the formula CuO. A black solid, it is one of the two stable </span>oxides<span> of </span>copper, the other being Cu2<span>O or cuprous </span>oxide<span>. As a mineral, it is known as tenorite and paramelaconite.</span>
5 0
3 years ago
Other questions:
  • Jason is researching the dangers and benefits of nuclear power. He found the following information. Source 1: Nuclear energy red
    13·1 answer
  • Can any one complete metric tic tac toe
    8·2 answers
  • 1. Why would it be difficult to recycle polyvinyl chloride into plastic bags?
    14·2 answers
  • A gas occupies 8.97 of volume when the temperature is 27.4C. Determine the new temperature for this gas when the volume becomes
    9·1 answer
  • Click the DeltaH is an Extensive Property button within the activity, and analyze the relationship between the two reactions tha
    8·1 answer
  • What else is produced during the combustion of propane, C3H8?
    7·1 answer
  • 5. Molds and bacteria contain hydrolytic enzymes used to breakdown proteins,
    15·1 answer
  • What is this please helpme
    14·2 answers
  • Dating of rock layers which layer is the youngest f,A,s,h,b,d,c,e
    10·1 answer
  • In order to determine the answer to a chemistry problem, a student first converted the given percentages to mole by assuming the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!