1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
3 years ago
8

Which advancement in technology has increased scientific knowledge of planets other than Earth?

Biology
2 answers:
kakasveta [241]3 years ago
5 0

Answer: The correct answer is rovers :)

Explanation:

I got it right!

antoniya [11.8K]3 years ago
3 0

I think Is Rovers they helped explore other planets such as mars

You might be interested in
Based on the information provided, what do you think the most ideal parameters would be for optimal glucose production?
Marysya12 [62]

The most ideal parameters for optimal glucose production are insulin sensitivity SI, glucose effectiveness SG, insulin action p2 and the volume of distribution of glucose V.

<h3>What is used for glucose production?</h3>

Insulin, glucagon, and hepatocyte-derived factors are used in these activities. Gut: Hormones are released in the gut in response to nutrition intake. These hormones affect hunger, stomach emptying, glucose production, and glucose elimination.

After eating, the beta cells release insulin into the bloodstream as your blood glucose levels rise. In order for glucose to enter muscle, fat, and liver cells, insulin works as a key to unlocking those cells. The majority of the cells in your body use glucose, lipids, and amino acids (the components of protein) as fuel.

By converting glycogen into glucose, a process known as glycogenolysis, the liver produces sugar or glucose. Additionally, the liver may produce the sugar or glucose that is required by harvesting amino acids, waste, and fat.

Learn more about glucose here:

brainly.com/question/18049945

#SPJ1

5 0
2 years ago
Which of the following is a possible ancestor to modern humans? a. Australopithecine Afarensis b. Australopithecine Robustus c.
BARSIC [14]
According to science, D would be the correct answer. Hope this helps!
7 0
3 years ago
Read 2 more answers
Which characteristics describe this rock sample?
WITCHER [35]

Answer:it's evidence of rapid cooling

And small crystals and rapid cooling

Explanation:

7 0
3 years ago
Which type of rna functions as a blueprint for dna in that it makes a copy of the dna for transport outside of the nucleus?
dalvyx [7]
The answer is attached in a file please read it

6 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Which pair of terms concerning the osmotic effect of a solution on red blood cells is mismatched?
    8·1 answer
  • Which example best shows conversation of resources
    15·2 answers
  • During the warm days of summer in the Arctic, mosquitoes breed exponentially When winter comes, the population falls off severel
    10·2 answers
  • Once the glucose molecule is split , what do we call the resulting 3 carbon structure
    10·1 answer
  • Which tends to increase the size of a population
    6·2 answers
  • Is it possible to find the same gene in two different kinds of organisms but not find the protein that is produced from that gen
    13·1 answer
  • Minerals enter roots through the process of
    7·2 answers
  • I need to match the definitions with the words.
    13·1 answer
  • Which of the following will occur if the concentration of membrane-impermeable solutes in the intracellular fluid of a cell is h
    11·2 answers
  • Question 20 of 32
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!