1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
siniylev [52]
3 years ago
5

The vast majority of land management methods implemented by corporations are voluntary.

Biology
2 answers:
KengaRu [80]3 years ago
6 0

tHiS iS fAlSe ^.^ LOL


Irina-Kira [14]3 years ago
3 0

Answer

False

Explanation

These practices describe the manner the land use outcome is attained. Land management methods implemented by corporations are a mandatory because they are a driver for better land use results economically, socially and environmentally. Corporations are required to understand the connection between land use , and land management practices to support sustainable land use policies


You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are the four commonly recognized objectives in the interrogation process?
USPshnik [31]
Interviews:
- Objective: purpose is to obtain Information
- Minimal legal requirements; no rights warnings
- cooperative relationship between interviewer and subject likely
- no guilt
- moderate planning
- Most Important: private and semiprivate; distraction could cause witness to forget key info

- Interrogations
- Objective: purpose is to test information already obtained, obtain valuable facts; eliminate the innocent; identify the guilty; obtain a confession
- extensive pre interrogation legal requirements; rights required
- hostile relationship likely
- guilt suggested
- extensive planning
- absolute privacy
7 0
3 years ago
Một phân tử ADN có cấu trúc xoắn kép, giả sử phân tử ADN này
Veseljchak [2.6K]

Answer:

umm I can't understand this I'm very very sorry but please put me on the brainliest

5 0
3 years ago
What is the male sperm producing organ?
spin [16.1K]

The testicles or testes

5 0
3 years ago
Which of the following statements is true?
QveST [7]

Answer:

3- As cells get larger, the volume increases more than the surface area

Explanation:

As a cell develops, it grows larger and extends the cell membrane. Sadly, the volume rises greater than that of the surface area, and therefore the relative surface area usable to transfer resources to a unit cell volume declines gradually.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What will natural selection eventually lead to in a population?
    5·1 answer
  • How are human economics and ecology linked
    15·1 answer
  • The nursing student asks the home health nurse what data is required for a medicare home plan of care. which item would be incor
    9·1 answer
  • Two functions of an oesophagus in a ruminant animal
    13·1 answer
  • Duchenne muscular dystrophy is an X-linked recessive disorder.
    13·2 answers
  • Which big cat is most aggressive and dangerous?
    6·1 answer
  • the amount of energy released and the amplitude of seismic waves are measured by the scale known as *NEED ANSWER NOW*
    15·1 answer
  • At the end of this phase, two new daughter cells that are exact replicas of the beginning cell will be completed.
    6·1 answer
  • The earth is nade up of 75%. Sources such as oceans have an important role in keeping Earth's surface insulated and warm. What p
    12·1 answer
  • 4
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!