1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Law Incorporation [45]
3 years ago
7

Which is a property of barium (Ba)?

Chemistry
1 answer:
777dan777 [17]3 years ago
4 0

Answer:

i think but i am not sure but according to me it mainly reacts yo non metals and i think its very reactive if my answer is wrong then comment below this question i will see it and i will get an opportunity to learn something new

You might be interested in
What is a tube like structure of neurons
Alekssandra [29.7K]
<span>It is known as the axon</span>
8 0
3 years ago
How can erode soil affect the body of water. ASAP​
Murrr4er [49]
Soil erosion has consequences that go beyond the loss of fertile land. It has resulted in an increase in contamination and sedimentation in lakes and rivers, clogging them and causing fish and other animals to decline. Degraded lands are also less capable of retaining water, which can exacerbate flooding.
6 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which of the following samples will have the greatest volume at STP?
Tamiku [17]

Answer:

Option b. 22 g of He will have the greatest volume at STP

Explanation:

In order to determine the volume, we apply the Ideal Gases Law equation:

P . V = n . R . T

V = n . R . T / P

R, T and P are the same in all the situation we must define n (number of moles).

The one that has the greatest number of moles will have the greatest volume at STP

22 g of Ne . 1mol / 20.1 g = 1.09 moles of Ne

22g of He . 1mol / 4 g = 5.5 moles of He

22 g of O₂ . 1mol / 32g = 0.68 moles of O₂

22 g of Cl₂ . 1mol / 70.9 g = 0.31 moles of Cl₂

4 0
2 years ago
Benzene has a specific gravity of 0.88. if it was spilled in a river what would it do?
Gelneren [198K]
As we know,
                    Density of Benzene  =  876 Kg/m³
And,
                    Density of Water       =  997 Kg/m³
So,
     Specific Gravity is calculated as,

                     Specific Gravity  =  Density of Benzene / Density of Water

                     Specific Gravity    =   876 Kg/m³ / 997 Kg/m³

                     Specific Gravity    =  0.878

Every object having specific gravity less than 1 will float on water and if value is greater than 1 then it will sink.

Benzene being non-polar in nature does not mix with water and due to less density it will float on the surface of water.
4 0
3 years ago
Other questions:
  • How to find the mass of 12dm³ of hydrogen, H2
    13·1 answer
  • A 425.00-gram sample of a compound decomposes into 196.01 grams of carbon, 41.14 grams of hydrogen, 130.56 grams of oxygen, and
    9·1 answer
  • The specific heat of nickel is 0.44 J/g*⁰C. How much energy needed to change the temperature of 95.4g of nickel from 22⁰C to 32⁰
    9·2 answers
  • Boron (B): 1sE2sF2pG E = F = G =
    7·2 answers
  • If the condition change such that there are 4 mil at 4 atm and at 270 K, what is the new volume?
    14·1 answer
  • Write the net ionic equation for the reaction of sodium chloride with magnesium hydroxide. Include the complete ionic equation a
    14·2 answers
  • A sample of iron (III) chloride has a mass of 26.29g. How many moles would this be?
    8·1 answer
  • Which of the following describes the products of a chemical reaction?
    8·1 answer
  • Entir<br> What is the striking back of<br> the<br> bunsen-<br> burner?
    8·1 answer
  • Identify each of the following compounds as: (a) a nonelectrolyte: lactose (c12h22o11) potassium chloride (kcl) lactic acid (hc3
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!