1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
2 years ago
5

What is an example of kinetic energy? Question 7 options: A frisbee flying through the air A car in the garage A box sitting on

a shelf A ball lodged in a tree
Chemistry
2 answers:
svlad2 [7]2 years ago
6 0
A frisbee flying through the air
Amiraneli [1.4K]2 years ago
4 0
Kinetic energy is energy that comes from motion. Anything that is currently in motion has kinetic energy.

Let’s look at each example to determine if they have kinetic energy.

First off, a car in the garage: let’s ask ourselves- Is the car in motion?
No, it is sitting in the garage. It is not moving; therefore it doesn’t have any kinetic energy.

Next, a box sitting on a shelf: let’s ask ourselves the same question- Is the box in motion?
No, it is sitting on the shelf. Again, it is not moving. It doesn’t have any kinetic energy.

Our third item is a ball lodged in a tree: again, we will ask ourselves the same question- Is the object moving?
No, it isn’t moving. Again, since it is not moving, it will not have kinetic energy.

Our last item is a frisbee flying through the air: asking ourselves the same question- Is it moving?
Yes, the object is moving. Yes, it has kinetic energy.

The frisbee flying through the air has kinetic energy.
You might be interested in
How many moles of Boron (B) are in 5.03 x 1024 B atoms?
goldfiish [28.3K]

Hey there!:

Number of moles =   ( number of atoms / 6.023*10²³ atoms )

given number of atoms = 5.03*10²⁴

Therefore:

Number of moles B = 5.03*10²⁴ / 6.023*10²³

Number of moles B = 8.35 moles

Hope that helps!


3 0
2 years ago
As a temperature of Lava increases, ___________.
levacccp [35]
B its viscosity decreases
3 0
3 years ago
Read 2 more answers
Hi everyone! :)) How is your day going, let me know!
Masja [62]

Answer:

its doing great!

Explanation:

breainleist plss

8 0
2 years ago
Read 2 more answers
Which substances will make a salt when combined? (2 points) Vinegar and antacids Soda and wine Soap and ammonia Fertilizer and d
SCORPION-xisa [38]

vinegar and antacids.

7 0
2 years ago
Read 2 more answers
How many degrees of unsaturation are lost or gained in the base-induced transformation from mito-ph to its photoactive ring-open
Fudgin [204]

Unsaturation (IHD) 2 hydrogen Needed

IHD = [(2n+2) -H]/2
(H: X=1, N=-1, O= zero)

Unsaturation:
Double bonds = 1
Rings = 1
Triple Bonds = 2

The degrees of unsaturation in a molecule are additive — a molecule with one double bond has one degree of unsaturation, a molecule with two double bonds has two degrees of unsaturation, and so forth.



6 0
3 years ago
Other questions:
  • Calculate the energy required to ionize a ground state hydrogen atom. report your answer in kilojoules.
    9·1 answer
  • What would happen if Phosphorus disappeared?
    10·1 answer
  • A chemical reaction in which one element replaces another element in a compound can be categorized as a
    13·1 answer
  • All of the atoms of argon have the same
    12·1 answer
  • What is the particle behavior of an liquid?
    7·2 answers
  • 3. The nucleus:
    11·1 answer
  • SOME HELP WOULD BE NICE!!! PLEASEEE
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What are the uses of hydrogen? ​
    8·2 answers
  • 5 Explain How can atoms make up all of<br> the substances around you? Explain you<br> reasoning
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!