1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
4 years ago
5

Choose the correct answer to complete the sentence. The animal group classified as being the most critically endangered is the _

____.
A.) birds
B.) amphibians
C.) fish
D.) reptiles
Biology
2 answers:
pishuonlain [190]4 years ago
5 0
I believe the correct response would be D. Reptiles.
Volgvan4 years ago
4 0

The best and most correct answer among the choices provided by your question is the fourth choice or letter D. Reptiles are the most critically endangered animal group. Their population is threatened due to illegal activities done by man like poaching. 

I hope my answer has come to your help. Thank you for posting your question here in Brainly.





You might be interested in
Which is the correct sequence for levels of biological organization within a multicellular organism?
9966 [12]

Answer:

Atom-Molecule-Organelle-cell-Tissue

Explanation:

Biological  is a hierarchical system that arranges biological structures in the order of complexity.

In the given sequence,

  • The atom is the simplest and smallest unit
  • Molecule-It is made up of two or more atoms
  • Organelle-A specialized structure within a cell
  • Cell- Is the smallest functioning unit of life and it contains organelles
  • Tissue-an assembly of cells that perform a specific function.
3 0
3 years ago
PLEASE HELP!!! THIS IS DUE IN A FEW HOURS!!! ALL 5 QUESTIONS!!!
Lilit [14]
This question is long and it is late here, but I can help you understand it. DNA consists of 4 nucleotide bases: Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). When DNA is transferred to RNA, you use the complimentary nucleotide base to each as follows:
Adenine changes to Uracil (replaces Guanine in RNA)
Thymine changes to Adenine
Cytosine to Guanine and vice versa
So, the DNA code ‘TAC’ will have the mRNA complimentary strand of ‘AUG’. When changing mRNA to tRNA, you do as follows:
Change A to U
U to A
C to G
G to C
It’s that simple. Then, to change to amino acids, you need to use the codon chart attached (a codon is 3 nucleotide base pairs)
For example, mRNA codon AUG codes for the amino acid Methionine. Hope this helps.
8 0
3 years ago
If two organisms have the same name in it does it mean they are closely related?
MA_775_DIABLO [31]

Answer:

yes

Explanation:

similar structure can indicate relatedness

8 0
2 years ago
How does a plant obtain the carbon dioxide it needs for photosynthesis
harkovskaia [24]

For photosynthesis green plants take carbon dioxide from the air. The carbon dioxide enters the leaves of the plant through the stomata present on their surface

8 0
3 years ago
Read 2 more answers
the testes hve both endocrine and exocrine functions. describe the endocrine and exocrine products tht come from the testes
qwelly [4]

The interstitial cells in the body produce testosterone for endocrine purposes. The seminiferous tubules' generation of spermatozoa constitutes the exocrine function.

<h3>What are Endocrine Functions of Testes?</h3>
  • The pituitary and hypothalamus regulate the amount of testosterone the testes make and secrete.
  • The pituitary gland receives a signal from the hypothalamus to release gonadotrophic chemicals (FSH and LH). The production of testosterone is stimulated by luteinizing hormone. The hypothalamus warns the pituitary gland to produce less LH, which instructs the testes to lower testosterone levels, if too much testosterone is being produced.
  • Boys' normal physical growth need testosterone. It is the principal androgen, which is a name for any chemical that promotes and/or supports the development of the male genitalia. Many of the processes that help a boy transition to manhood during puberty require testosterone, including:
  1. healthy growth of male genitalia
  2. growth of body and face hair
  3. reduction in voice volume
  4. Adam's apple development

To learn more about Endocrine Functions of Testes with the given link

brainly.com/question/14290574

#SPJ4

7 0
2 years ago
Other questions:
  • Which statement best describes the United States' Cold War policy of containment?
    14·2 answers
  • Choose an example of mutualism, and then describe the long process by which the relationship could have developed. quizlet
    9·2 answers
  • What is homeostasis (full explanation no copy right plz)
    9·1 answer
  • According to the Köppen climate classification system, _____.
    15·2 answers
  • Which of the following explain why sunlight is important to aquatic ecosystem?. -Sunlight provides a source of heat energy to in
    10·1 answer
  • What amount of earths total water supply is usable fresh water?
    6·2 answers
  • The current knowledge concerning cells is the result of the investigations and observations of many scientists. The work of thes
    7·1 answer
  • Explain how cell organelles are similar to an organ system.
    6·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • The human brain communicates with the rest of the body through networks of what?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!