1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
4 years ago
5

Every career choice has both positive and negative aspects. Please select the best answer from the choices provided. T F

Health
2 answers:
madreJ [45]4 years ago
7 0
The answer would be true
N76 [4]4 years ago
3 0
The answer to this question would be true
You might be interested in
Question 18
Arturiano [62]
Hm. I believe it may be false but I may be incorrect.
3 0
3 years ago
Read 2 more answers
Some health agencies support this while others do not. Do you think this is a wise approach to addressing the obesity in childre
posledela

Answer: Yes I do think it is wise

Explanation:

I think it is wise to address obesity in children because you can easily prevent obesity in children and help the people down the road if you just feed them healthy from the start. Feeding children sugary sweets is very easy and is cheaper than buying all organic and all natural food, but if you don't feed your child sugar from the start then they won't get used to eating bad stuff for them. They will be used to eating good foods and are least likely to start eating bad food and will most likely not be obese.

6 0
3 years ago
How can you use your personal choices to exercise more safely?
n200080 [17]
The answer would be A
6 0
3 years ago
Two parents set appropriate boundaries for their children, treat them with love and respect, listen to their concerns, and give
Greeley [361]

Answer:

its between  2 and 4

Explanation:

6 0
4 years ago
Read 2 more answers
A term psychologists use to describe your opinion of yourself is called _____. self-actualization self-esteem self-pity self-res
worty [1.4K]
The correct answer is self esteem
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is true about measles and chicken pox?
    15·1 answer
  • Which type of fat may help lower the risk of heart disease?
    14·1 answer
  • In order to gain the maximum benefits from an exercise program, you should include both cardiovascular training and weight train
    8·2 answers
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • 50 POINTS
    11·2 answers
  • Which organization was formed by Clara Barton
    14·2 answers
  • I'm struggling with this can you help me <br><br>NO SCAMMERS ALLOWED ​
    8·1 answer
  • Life expectancy is
    5·2 answers
  • I need help today!!!! I will mark you Brainliest!!!!! Describe in detail what you believe to be the 3 greatest physical benefits
    6·1 answer
  • One type of personal health moniter can predict the amount of calories a person burns. Is this true or false?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!