1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
5

Which of these is a unique property of acids?

Chemistry
1 answer:
geniusboy [140]3 years ago
8 0
I would go with taste sour just because lemon is considered as acid
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Please help help help help
Anni [7]

Answer:

50000 dollars or 5 e5

Explanation:

Mr. Garibay has 5.0 * 10^4 dollars in his bank.

Scientific notation represents the data in the format of expanded number or with e character.

For instance, 5.0 * 10^4 dollars = 50000 dollars or 5 e5

3 0
3 years ago
Which solution has the greatest number of hydroxide ions?
professor190 [17]
Baking soda. to put in the most simple terms..

-OH is the "base" anion
H+ is the "acid" ion

5 0
3 years ago
Read 2 more answers
Which of the following is the main evidence of life in the early universe?
alukav5142 [94]
<span>A)photosynthetic bacteria</span>
3 0
3 years ago
Read 2 more answers
What is the mass, in grams, of a liquid having a density of 1.50g/mL and a volume of 3500mL
mojhsa [17]

Answer:

5,250g

Explanation:

Density = Mass / Volume

*Note: mass = x

1.50g/mL = x / 3500mL

multiply 3500mL on both sides

1.50g/mL * 3500mL = 3500mL(x) / 3500mL

cancel units

x = 5250g

5 0
2 years ago
Other questions:
  • What is the correct Lewis structure for Acetylene C2H2?
    12·1 answer
  • What mass of glucose can be produced from a photosynthesis reaction that occurs using 10 moles of carbon dioxide?
    12·2 answers
  • What can happen when earth materials overcome the force of friction holding them together?
    11·1 answer
  • Lanthanides and Actinides are metals, nonmetals, or metalloids.
    14·1 answer
  • The rhythmic use of spoken or semi-sung lyrics is called:
    13·1 answer
  • What period is Pb in
    15·1 answer
  • I just need to know which ones are insulators and the others conductors
    6·1 answer
  • Ar
    15·1 answer
  • Help asap plz thank you!
    7·2 answers
  • Calculate the number of oxygen atoms and its mass in 50g of CaCo3<br>​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!