1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
4 years ago
6

Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two sampl

es isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 21.3 % thymine and sample B contains 28.7 % thymine. Assume the organisms contain normal double‑stranded DNA and predict the composition of the other bases.sample A contains 21.1% Thymine - %A
sample B contains 27.1% Thymine - %A
number - %G
number - %G
number - %C
number - %C
Both samples are then denatured to remove the secondary structure.which will have the higher temperature to denature A or B ?
Biology
1 answer:
SVETLANKA909090 [29]4 years ago
4 0

Answer:

Sample A

T= 21.3% and A= 21.3%

G=28.7% and C= 28.7%

SAMPLE B

T=28.7% and  A= 28.7%

G= 21.3% and C= 21.3%

Sample A would have higher melting temperature

Explanation:

According to given information, sample A contains 21.3% thymine.

Percentage of adenine in sample A= 21.3% (Since adenine base pairs with thymine, so, adenine and thymine are present in equal amount in a double stranded DNA)

Total of A+T in sample A= 21.3 + 21.3 = 42.6%

G+ C content of sample A= 100-42.6= 57.4%

Percent G content of sample A = 57.4/2 = 28.7%

Percent C content of sample A = 28.7%

SAMPLE B:

According to the given information, sample B contains 28.7% thymine.

Therefore, percent of Adenine base in sample B= 28.7%

Total of A+T content in sample B= 28.7 + 28.7 = 57.4%

G + C content of the sample B = 100-57.4= 42.6%

Percent G content of the sample B= 42.6/2= 21.3%

Percent C content of sample B = 21.3%

There are three hydrogen bonds between a GC pair while there are only two hydrogen bonds between AT pair. The DNA content with higher GC content has higher melting temperature. Therefore, sample A would have higher melting temperature.

You might be interested in
Which of the following populations would be considered r-selected? Black Widow Spiders - they produce 1000s of offspring and few
belka [17]

Answer:

Option 1.

Explanation:

r-selected species may be defined as the species that has higher growth rate, shows less parental care and the rate of survival of the off spring is low as compared  with k selected species.

Black widow spiders have the ability to produce 1000 offspring. Their chances of survival are extremely low and only few species of black widow spiders survive. Hence, black widow spider is r-selected species.

Thus, the correct answer is option (1).

7 0
4 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
__________ is the least developed of a newborn baby's senses. taste sound vision touch
dexar [7]
 Vision is the least developed of a newborn baby's senses. <span>The visual capacity of the baby develops progressively in the first 8 months. From then on, the baby's vision will be as good as that of the adult. Although at birth, the eyes of the newborn have the physical ability to see without problems, your brain is not yet ready to process all that information; that's why he sees everything blurred. With the development of the brain, your visual ability improves.</span>
5 0
3 years ago
HELP I NEED IT RIGHT NOW.. BRAINLIEST
SCORPION-xisa [38]

Answer:

A or D

Explanation:

5 0
2 years ago
Read 2 more answers
How does biodiversity affect humans?​
defon

Biodiversity affects humans by: underpins the health and has a direct impact on all of our lives. To summarize reduced biodiversity means millions of people face a future where food supplies are more vulnerable to pests and disease, and where fresh water is in irregular or short supply. For humans that is worrying.

7 0
3 years ago
Other questions:
  • Which can adapt to changes A. alleles B. population C. offspring D. individuals
    5·1 answer
  • A location in the northern hemisphere is currently experiencing equal sunlight as another location in the southern hemisphere. W
    13·2 answers
  • Semen is a combination of A) fluid from the seminal glands and bulbo-urethral glands B) fluid from the prostate and sperm C) sem
    10·2 answers
  • Help please please please<br> :)
    14·1 answer
  • Which characteristic do ferns have that mosses do not?
    7·1 answer
  • What other hypotheses can you suggest concerning yeast's ability to use fermentation to make atp? (refer to "alcohol" page in la
    8·1 answer
  • Cell respiration begins with
    8·1 answer
  • How many layers are in a gram positive cell wall and how many are in a gram negative cell wall ?
    9·2 answers
  • HELP SUPER IMPORTANT!!The sodium-potassium pump is vital to the proper function of which body system
    12·1 answer
  • Any one can please fill all the labellings.<br>thanks:)​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!