Answer:
Strong acid breaks up into ions
Explanation:
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
1.67mol/L
Explanation:
Data obtained from the question include:
Mole of solute (K2CO3) = 5.51 moles
Volume of solution = 3.30 L
Molarity =?
Molarity is simply the mole of solute per unit litre of the solution. It can be expressed mathematically as:
Molarity = mole of solute /Volume of solution
Molarity = 5.51 mol/3.30 L
Molarity = 1.67mol/L
Therefore, the molarity of K2CO3 is 1.67mol/L
When using ion-selective electrodes, to compensate for a complex or unknown matrix, the standard addition method can be used to determine the analyte concentration. Option D
<h3>What are ion-selective electrodes?</h3>
Analytical chemistry is a science that deal with the measurement and detection of the accurate amount of a substance. Analytical chemistry plays a large role in environmental management as it helps in the determination of the levels of contaminants in a sample.
An ion selective electrode is used in analytical chemistry to measure the amount of a target ion by converting its activity into a measurable electrical signal.
Hence, when using ion-selective electrodes, to compensate for a complex or unknown matrix, the standard addition method can be used to determine the analyte concentration.
Learn more about ion-selective electrodes:brainly.com/question/14987024
#SPJ1
Three elements that are likely to have similar chemical and physical properties are