1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
9

In this experiment, 1-2 mL of saturated sodium chloride is used to transfer the crude product after the initial distillation. Wh

y is saturated sodium chloride, rather than pure water, used for this procedure?
Chemistry
2 answers:
lina2011 [118]3 years ago
6 0

<span>Saturated sodium chloride is used to transfer the product rather than water since it is not polar and rinsing the product with water would revert any 4-methylcyclohexene back to 4-methylcyclohexanol in the Hickman Head and thus lowering the percent yield; using water would shift the equilibrium towards the reactants.  Also sodium chloride removes the small amount of phosphoric acid and also a small amount of water.  If one were to add water, both 4-methylcyclohexene and phosphoric acid are partially soluble making difficult to remove the water later; sodium chloride makes the water less reactive so easier to remove by making the aqueous later more polar.</span>

IgorC [24]3 years ago
3 0

Answer:

Because it helps to remove water from the system.

Explanation:

The saturated sodium chloride solution has a strong affinity for water molecules and there is the possibility of changing the saturated solution to a dilute solution in the presence of pure water. Because of these reasons, the saturated sodium chloride solution removes water molecules from the system to become a diluted solution. That is the reason why the saturated solution was used instead of pure water.

You might be interested in
Which characteristic of a strong acid
olga nikolaevna [1]

Answer:

Strong acid breaks up into ions

Explanation:

7 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
An aqueous potassium carbonate solution is made by dissolving 5.51 moles of K 2 CO 3 in sufficient water so that the final volum
ad-work [718]

Answer:

1.67mol/L

Explanation:

Data obtained from the question include:

Mole of solute (K2CO3) = 5.51 moles

Volume of solution = 3.30 L

Molarity =?

Molarity is simply the mole of solute per unit litre of the solution. It can be expressed mathematically as:

Molarity = mole of solute /Volume of solution

Molarity = 5.51 mol/3.30 L

Molarity = 1.67mol/L

Therefore, the molarity of K2CO3 is 1.67mol/L

3 0
3 years ago
Read 2 more answers
When using ion-selective electrodes, to compensate for a complex or unknown matrix, the _____________ method can be used to dete
VMariaS [17]

When using ion-selective electrodes, to compensate for a complex or unknown matrix, the  standard addition method can be used to determine the analyte concentration. Option D

<h3>What are  ion-selective electrodes?</h3>

Analytical chemistry is a science that deal with the measurement and detection of the accurate amount of a substance. Analytical chemistry plays a large role in environmental management as it helps in the determination of the levels of contaminants in a sample.

An ion selective electrode is used in analytical chemistry to measure the amount of a target ion by converting its activity into a measurable electrical signal.

Hence, when using ion-selective electrodes, to compensate for a complex or unknown matrix, the  standard addition method can be used to determine the analyte concentration.

Learn more about ion-selective electrodes:brainly.com/question/14987024

#SPJ1

7 0
2 years ago
How many grams of magnesium would contain the same number of atoms as 26.982 grams of aluminum?
vlabodo [156]
Three elements that are likely to have similar chemical and physical properties are
5 0
3 years ago
Other questions:
  • Which statements describe how stars are born? Check all that apply. Stars are born in clouds of gas and dust called nebulas. The
    7·2 answers
  • How many lone pairs of electrons are on the central carbon atom in a Lewis Structure of CHI3?
    8·1 answer
  • Aluminum chloride can be formed from its elements:
    9·1 answer
  • What is the mass of the missing reactant in the following reactions, given that the reaction goes to completion? Do not include
    15·1 answer
  • When NH3(g) reacts with O2(g), the products of the combustion are NO(g) and H2O(g). What volume of O2(g) is required to react wi
    5·1 answer
  • Which of the following is a possible m/value for an s orbital?
    6·1 answer
  • The following data were measured for the reaction BF3(g)+NH3(g)→F3BNH3(g): Experiment [BF3](M) [NH3](M) Initial Rate (M/s) 1 0.2
    13·1 answer
  • Why can't we carry an umbrella during lighting?
    5·1 answer
  • Describe the stages of volcanic activity
    6·1 answer
  • Which two elements are combined in hydrogen sulfide
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!