1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Law Incorporation [45]
3 years ago
15

a compound is found to have 46.67% nitrogen, 6.70% hydrogen, 19.98% carbon and 26.65% oxygen, what is the empirical formula?

Chemistry
1 answer:
uranmaximum [27]3 years ago
4 0
Search up “Chemistry, how to do empirical formulas” a guy named Tyler Dewitt is really good at explaining
You might be interested in
Hecking skills activated
artcher [175]

Answer:

yes 34

Explanation:

4/13 =0.307

7 0
2 years ago
Read 2 more answers
4.3 moles of a gas are at a temperature of 28 degrees * C with a pressure of 1.631 atm. What volume does the gas occupy?
Shkiper50 [21]

Answer:

65.2L

Explanation:

Using the general gas equation;

PV = nRT

Where;

P = pressure (atm)

V = volume (Litres)

n = number of moles (mol)

R = gas law constant (0.0821 Latm/molK)

T = temperature (Kelvin)

According to the information provided in this question,

P = 1.631 atm

V = ?

n = 4.3 moles

T = 28°C = 28 + 273 = 301K

Using PV = nRT

V = nRT/P

V = 4.3 × 0.0821 × 301 ÷ 1.631

V = 106.26 ÷ 1.631

V = 65.15

Volume of the gas = 65.2L

7 0
2 years ago
Describe how you would set up an experiment to test the rela-tionship between completion of assigned homework and the fi-nal gra
ValentinkaMS [17]

To start this test, you need to identify the variables it presents. As you may already know, there are independent and dependent variables. Independent variables are those that act on a factor, influencing it to generate a result. In the case of this experiment, the independent variable is the completion of the homework. The dependent variable, in turn, is the factor that receives the influence of the independent variable, in this experiment this variable is the final grade you received in the course.

After that you must select a number of students, give them their homework and ask each student to complete a percentage of that amount. An example of this could be that you select 11 students and ask the first to complete 0% of the homework, the second student must complete 10%, the third 20% and so on, and the 11th student must complete 100% of the homework.

after that, note what was the final grade that each student received in the course and make a graph to show the results.

The y-axis of the graph must represent the dependent variable, while the x-axis must represent the independent variable. This way you will show the exact relationship between completing homework and the final grade of the course.

7 0
3 years ago
Can a molecule have polar bonds, but still be a no polar molecule?
My name is Ann [436]

<em><u>A molecule </u></em><em><u>can </u></em><em><u>possess polar bonds and still be nonpolar.</u></em>

I hope this helped. Have a nice day, make sure to take care of yourself. You're loved <3

5 0
3 years ago
Read 2 more answers
Find mass of 3 moles of water​
EleoNora [17]

Answer:

54 g

Explanation:

1 mole of water = H2O

mass of 1 mole of H2O= mass of h2 + mass of o

= 2× mass of h +mass of o

= 2×1+16 =18 g

1 mole of water = 18g

3moles of water = 18×3g= 54g

6 0
3 years ago
Other questions:
  • On the periodic table, the majority of elements are classified as
    10·2 answers
  • Are all physical reactions reversible?
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which layer of earth has the greatest pressure?
    13·1 answer
  • How to calculate atomic mass?
    7·2 answers
  • According to de Broglie, which of these objects does not have a wavelength?
    9·1 answer
  • 5 kinds of trace fossils
    10·1 answer
  • Which sample is most likely to undergo the smallest change in temperature upon the absorption of 100 kJkJ of heat
    7·1 answer
  • The Earth's Layers
    6·2 answers
  • Who ever answer this is genius ????????? <br><br><br>let's see?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!