<span>The RNA world is the hypothesized format of chemical life that existed prior to our current DNA and RNA world. In the RNA world, RNA molecules formed in the primordial soup and began to evolve by self-replication and mutation. This led to increased complexity, natural selection of "better" RNA and diversification of RNA based life.</span>
Answer:
The energy an object had due to its motion. What factors affect an objects kinetic energy and potential energy? The kinetic energy of an object depends on both its mass and its speed. Kinetic energy increased as mass and speed are increased.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Comets are most like planets have elliptical orbits
