1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
14

Zinc phosphide, Zn3P2, is often used as a rat poison. Phosphorus has 5 valence electrons. How many valence electrons does each z

inc atom lose?
Chemistry
2 answers:
Helen [10]3 years ago
8 0
The choices that should have accompanied this question were:
A. 1 
<span>B. 2 </span>
<span>C. 3 </span>
<span>D. 4 
</span>
My answer is B. 2.
Below is an explanation, I found while doing the research.

<span>Phosphate needs 3 electrons each totaling 6 electrons so each zinc will need to give up 2 electrons.

Phosphate wants to imitate the electron configuration of Argon because noble configurations are the most stable. With P getting the extra electrons the valence shell will be 3s2 3p6, which is the same as Argon. Without the extra electrons, the P valence shell looks like this 3s2 3p3, now you can see why each phosphorus wants 3 more electrons, that will make it 3s2 3p6, just like Argon.</span>
ryzh [129]3 years ago
6 0

Answer:

The correct answer is two valence electrons.

Explanation:

Hello! We will answer this!

As the phosphorus has 5 valence electrons, in the first layer it has 2, so the ones it combines are 3. In total there are 6 negative phosphorus charges because they are two phosphorus atoms. The number of Zinc atoms is 3 so to balance the loads, you have to have +2 so that in total there are 6 charges.

The correct answer is two valence electrons.

You might be interested in
Write this in a word and skeleton equation:
DiKsa [7]

Answer:

Write this in a word and skeleton equation:

Solid silver chloride and an aqueous solution of nitric acid are produced when a solution of silver nitrate is reacted with a solution of hydrochloric acid.

Explanation:

6 0
2 years ago
A boron atom has ____ electrons at the first energy level and ____ electrons at the second energy level.
mylen [45]

Answer: A boron atom has 2 electrons at the first energy level and 3 electrons at the second energy level.

5 0
3 years ago
A chemist takes 50-gram sample of sulfur powder that has a melting point of 115.2 °C. What is the melting point of a 100-gram sa
JulijaS [17]
I would say that B is the correct answer which means that the melting point would be intensive or that no matter how large or small the sample of the sulphur is, it will have a consistent melting temperature or of 115.2 degrees C. 
3 0
3 years ago
Read 2 more answers
How can a knowledge of chemistry help you be a more informed citizen?
galina1969 [7]
Terms in this set (28) Explain how knowledge of chemistry can be a more informed citizens? Knowledge of chemistry and other sciences can help you evaluate the data presented, arrive at an informed opinion, and take appropriate action.
8 0
3 years ago
Which of the following is a measure of velocity?
padilas [110]

The correct answer is 30 seconds

6 0
3 years ago
Read 2 more answers
Other questions:
  • Would 0.12g/cm^3 float in water?
    14·1 answer
  • True or False: PERIODS on the periodic table run up and down.
    7·2 answers
  • Planetesimal definition
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • During an experiment, distilled water was placed in a sealed container and the container was heated gradually. Describe this sys
    11·1 answer
  • Which element is placed in the same period as ruthenium but has a higher atomic number than it?
    5·1 answer
  • Why would you weight less on a high mountain peak than you would at sea level?
    7·1 answer
  • Question 2 (0.5 points)
    6·1 answer
  • Which option correctly describes the relative charges and masses of the subatomic particles?
    6·1 answer
  • CH2CH3<br> CH3CH2-C-CH2CH3<br> CH3<br> what’s the IUPAC name?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!