1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tia_tia [17]
3 years ago
11

Miles draws three cards at random from a standard deck of 52 cards, without replacement.

Mathematics
1 answer:
o-na [289]3 years ago
4 0

Answer:

P( red, red, red no replacement ) =  2/17

P( 3 cards with same rank, no replacement) =  1/425

Step-by-step explanation:

There are 52 cards, 26 are red

P( red) =  red/total =26/ 52 = 1/2

Now draw the second card without replacement

There are 51 cards, 25 are red

P( red) =  red/total =25/51

Now draw the third card without replacement

There are 50 cards, 24 are red

P( red) =  red/total =24/50 = 12/25

P( red, red, red no replacement ) = 1/2 * 25/51 * 12/25 = 2/17

P ( all have the same rank)

There are 52 cards,  4 of each rank

We don't care what the first rank is, now the second and third draw have to have the same rank as the first

P( rank) = 1/1

Now draw the second card without replacement

There are 51 cards, 3 are left with the same rank

P( same rank) = cards with same rank/total = 3/51

Now draw the third card without replacement

There are 50 cards, 2 are left with the same rank

P( same rank) = cards with same rank/total = 2/50 = 1/25

P( 3 cards with same rank, no replacement) = 1 * 3/51*1/25 = 1/425

You might be interested in
Help confused thanks
sukhopar [10]
\left[\begin{array}{cc}Juice&Water\\1&3\\2&6\\3&9\\4&12\\\end{array}\right]

w=3j
36=3j
j=\frac{36}{3}=12cups
3 0
2 years ago
Find the domain and range of the exponential function h(x) = –343^x. Explain your findings. As x decreases, does h increase or d
Snowcat [4.5K]

Answer:

As x decreases, h increases (but never touches)

As x increases, h decreases (but never touches)

Step-by-step explanation:

If you graphed the exponential, you would be able to see that it is stuck in the 3rd quadrant.

Domain: (negative infinity, 1)

Range: (negative infinity, 0)

7 0
3 years ago
The solution to 4.2x = 19.32 is x = ___. 0.28 0.45 4.6 15.12
AVprozaik [17]
The solution to this equation is x=4.6 because 19.32/4.2=4.6
8 0
2 years ago
Read 2 more answers
HELP ASAP! Will name brainliest!
eimsori [14]

Answer:

mean:8,median:8,mode:8

Step-by-step explanation:

sori cant do the second one

8 0
2 years ago
How do you do a ratio tape diagram
sp2606 [1]
15 degrees hope this helps mark as brainliest
7 0
2 years ago
Other questions:
  • A bus can carry 50 people per run. At least how many times does the bus have to run in order to transfer 25,000 people?
    11·2 answers
  • PLZ ANSWER WILL GIVE BRAINLIEST TO CORRECT ANSWER!!! World renowned ice cream entrepreneurs Sydney and Eden produce two types of
    12·1 answer
  • Is this statement true or false
    15·1 answer
  • THIS IS A MULTI CHOICE ANSWER
    10·1 answer
  • Draining a half cylinder tank. A trough is shaped like a half cylinder with length 5 m and radius 1 m. the tank is full of water
    10·1 answer
  • Which expression is equivalent to the given expression? 17x−32x
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Given O below, is XY a minor arc, a major arc, or a semicircle?
    15·2 answers
  • Is the following relation a function?
    13·1 answer
  • PLEASE ANSWERRRRRRRRRRRRR
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!