1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zepelin [54]
3 years ago
14

In open areas and around vessel swim platforms, certain activities should be avoided. what activity should be avoided in order t

o keep away from carbon monoxide
Biology
1 answer:
salantis [7]3 years ago
8 0

<span>In order to avoid carbon monoxide poisoning in an open areas or / and around vessel platform, especially when boating, it should be that swimmers will not be allowed to enter any enclosed area under the swim platform or dive platform even for a second. It is already an enclosed area for a given reason, and that one reason is to avoid being poisoned by carbon monoxide. Although not only because of carbon monoxide, surely the area is enclosed because of other reasons too. Carbon Monoxide is an odorless and tasteless gas, even colorless that will slightly kill not only people but to any hemoglobic animals. Which we all know, hemoglobin is present in every animal’s red blood cells, including humans.</span>

You might be interested in
How many amino acids are found in living organisms
loris [4]
20.

They told me that my answer was too short so I'm just adding this on, don't mind me.                                    
5 0
3 years ago
Remnants of osteons, which have been almost completely recycled by osteoclasts, are known as __________
Alex

Answer:

Lamellae

Explanation:

These lamellae are remnants of osteons whose matrix components have been almost completely recycles by osteoclasts. growth of the bone.

3 0
1 year ago
If 14 more flamingos landed in the pond on the bottom, what would the population density be them?
Andreyy89

Answer:

option C

Explanation:

happy day ahead y

6 0
3 years ago
Read 2 more answers
Name and define the two main kinds of reproduction
inysia [295]
Asexual And Sexual is the correct answer
4 0
3 years ago
Given the names of these three enzymes proteases, DNase, RNase what reaction do you expect each one to catalyze
kramer

Answer:

As the name suggests, proteases will be the enzymes which will catalyze the reactions of proteolysis. Proteolysis can be described as the process of breaking proteins into amino acids and simple peptide bonds.

DNases will catalyze the reactions for breaking down or degrading DNA. The DNase does this by breaking the phosphodiester bonds present in the backbone of the DNA.

RNases will be the enzymes which will catalyze the breaking of RNA molecules.

6 0
3 years ago
Other questions:
  • While awaiting surgery, a client with a long history of crohn disease is receiving total parenteral nutrition (tpn) on an outpat
    11·1 answer
  • This is a two-part process that ends in the assembly of proteins at the ribosomes within cells. The first part
    15·1 answer
  • Why is important that scientist present their work to other scientists?
    14·2 answers
  • How does the cell membrane control what comes in and out of the cell?
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the substance found in cell walls of diatoms
    11·2 answers
  • Necesito ayuda LANSLAKALAKANAKAKAMALALJSLWKSNAKAKAKA​
    6·1 answer
  • What are some limitations of the scientific method and science?
    12·1 answer
  • Dandelions grow quickly and produce many seeds, ensuring that at least some plants will survive and produce seeds themselves. Wh
    7·1 answer
  • Which atrial dysrhythmia has a cardiac complex that occurs too soon and may have abnormal p waves, but other than being ''early,
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!