Receptors which provide animals with information from the external environment are located in ears, tongue, eyes, and the nose. These are all receptors that can be found in our sensory organs and provide us with feedback from our nearby environment and the stimuli on which we should be alerted towards.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The answer to this question would be...
B. Thousands
If you go to webpage <span>http://www.shapeoflife.org/2d-animal-cells-have-many-thousands-genes it will give you the same answer if you read through it.
Hope this helps a lot, leave a rating and like if it did!</span>
Answer:
Columbia CNA agar is a type of selective medium employed in culturing gram positive cocci and distincting it from clinical and nonclinical samples made up of a combined flora. Columbia CNA SHOULD NOT BE COMPARED with general culture medium such as the Nutrient agar which provides the necessary nutrients for the growth of diverse species of organisms.
Good growth stands for the growth of organisms picked or needed to culture with the required amount of colonies on Columbia CNA. Poor or no growth infers on the NA availability for the growth of the specimen organism, it is absent in the culture as it lacks the needed amount of colonies.
In conclusion, It may look good to look for the similarities and differences of the organisms to one another on the CNA plate since the NA plate is mainly the control and is used to evaluate the growth quality of the bacteria, contrasting it to the CNA plate is of no use as its main reason would be futile.
Answer:
The correct answer is: d.a nonpolar side chain.
Explanation:
- Protein can be defined as one of the factors which determine the structure as well as the function of a cell.
- Proteins are composed of polymeric chains of polypeptides, which are made up of amino acid monomers linked to each other by peptide bonds.
- Amino acids can be broadly categorised into non-polar and polar based on the nature of the side chain.
- The non-polar amino acids possess hydrocarbon side-chains which are hydrophobic in nature, so they tend to avoid interaction with water molecules and usually remain in the protein interior. They are uncharged and cannot form any hydrogen bonds with water molecules.
- The polar amino acids possess charged or polar side-chains which are hydrophilic in nature, so they tend to undergo interaction with water molecules and usually remain on the protein surface. They can form hydrogen bonds with molecules of water.
- Beta sheets can be defined a secondary structure of the protein in which the polypeptide sequence forms horizontal strands which are linked to each other by loops. Each strand interact with each other by the formation of hydrogen bonds between the C=O group of one peptide (amide) bond in one strand with the N-H group of another peptide (amide) bond in another strand.
- Apart from these bonds, the non-polar side chains of each amino acid in one strand forms hydrophobic or Van der Waals interactions with the non-polar side chains of each amino acid in the other strand. The polar or charged side chains of the amino acids on each strand form either hydrogen bonds with water molecules or with oppositely charged side chains.
- In the given question, glycine and alanine are non-polar amino acids but serine is a polar amino acid. The side-chains of the non-polar amino acids will tend to face towards the interior of the beta sheet thereby forming hydrophobic interactions with each other, while the serine will tend to face the exterior of the beta sheet so that it can form hydrogen bonds with water molecules.
- As the number of non-polar amino acids is far more than polar amino acids so the effect of non-polar amino acids will prevail in the beta-sheet.
