1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
13

What Is Modern Methods Of Agriculture Practices And its Advantages?

Chemistry
1 answer:
Olin [163]3 years ago
7 0

Answer:

Explanation:

Modern Agriculture - The agricultural practices with modern technique like Fertilizers, Innovative hybrid seed, and utilization of machine call modern Agriculture.

Advantages -

Feeding to the population without scarcity of food grains.

Optimum Utilization of land (Crop intensity more then 300%)

Increased production of food grain.

Global Market - even our mangoes available at US and we are getting California apple too.

Due to factories and Machine use this industry is growing to and empowering good employment.

I hope this helps you :)

You might be interested in
What volume of 12M HCI is needed to prepare 250<br> of 0.20M HCI?
Alchen [17]

Answer: 4.2

Explanation:

M_{A}V_{A}=M_{B}V_{B}\\(12)V_{A}=(250)(0.20)\\V_{A}=\frac{(250)(0.20)}{12}=\boxed{4.2}

6 0
1 year ago
Sugar dissolving in tea is it chemical or physical change?​
coldgirl [10]

Answer:

it is a physical change because when you heat up again a solution of sugar and tea you gonna obtain again sugar

5 0
3 years ago
8 DO
Goryan [66]

Answer:

Increased use of resources

Additional waste produced

More construction

Cutting down trees

3 0
3 years ago
How much water should be added to 4.3 moles of LiBr to prepare a 2.05 m solution?
arsen [322]

Answer:

2.1 kg of water

Explanation:

Step 1: Given data

  • Moles of lithium bromide (solute): 4.3 moles
  • Molality of the solution (m): 2.05 m (2.05 mol/kg)
  • Mass of water (solvent): ?

Step 2: Calculate the mass of water required

Molality is equal to the moles of solute divided by the kilograms of solvent.

m = moles of solute/kilograms of solvent

kilograms of solvent = moles of solute/m

kilograms of solvent = 4.3 mol /(2.05 mol/kg) = 2.1 kg

8 0
2 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Other questions:
  • I NEED HELP PLEASE !!!!
    8·2 answers
  • Calculate the percent error in calculating the pH of a 0.040 M HCl solution that is also 0.010 M in HNO3 using ionic strength an
    15·1 answer
  • When comparing the two elements cd and ge , the larger element is based on periodic trends alone?
    12·1 answer
  • Bromine is the only nonmetal that is a liquid at room temperature. consider the isotope bromine-81, . select the combination whi
    13·1 answer
  • Water at 25 °C flows at 5 ft/s through a straight cylindrical tube made of benzoic acid, with a 1-inch inside diameter. If the t
    14·1 answer
  • the reaction below shows a system in equilibrium how would an increase in the concentration of chemicals affect this reaction?
    9·1 answer
  • The atomic mass of hydrogen is 1.01. What is the mass of hydrogen in one mole of aluminum hydroxide (Al(OH)3)?
    11·1 answer
  • To try and stimulate the correct distance, how close would you put the animal
    9·2 answers
  • Hey! Could someone explain how to do this? Thanks!
    11·1 answer
  • A gas at constant volume has a pressure of 4. 50 atm at 200. K. What will be the pressure of the gas at 250. K? 3. 60 atm 4. 60
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!