1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
13

Bromine is the only nonmetal that is a liquid at room temperature. consider the isotope bromine-81, . select the combination whi

ch lists the correct atomic number, number of neutrons, and mass number, respectively.
Chemistry
1 answer:
s344n2d4d5 [400]3 years ago
5 0
<span>Answer:
atomic number=35
number of neutrons=46
mass number=81
</span>

The number that written on isotopes is showing the mass number of the molecule, so Bromine-81 mass number is 81. The <span>atomic number of bromine(look at the periodic table) should be 35 which means it has 35 protons. The number of neutron should be: mass-proton= 81-35= 46.</span>
You might be interested in
A gas occupies a volume of 60 L at a temperature of 0.5 K. What will the volume be at 4 K?
Flauer [41]

Answer:

480 L

Explanation:

In order to solve this question, you should be familiar with gas laws. (I will attach a picture showing all of them under my answer.) In this question in particular, however, we only need Charles's Law because we're dealing with temperature and volume.

As we can see, Charles's Law is:

\frac{V_{1} }{T_{1} } = \frac{V_{2} }{T_{2} }

or, initial volume over initial temperature equals final volume over final temperature.

In this question, 60 L is our <u>initial volume,</u> and 0.5 K is our <u>initial temperature</u> (K being Kelvin). We are only given 4 K as our <u>final temperature</u>. We are asked to solve for the <u>final volume</u>. Let's set up the equation and solve for V_{2}:

--------------------------------------------------------------------------------------------------------------

(60) / (0.5) = V_{2} / (4)

↓

120 = V_{2} / 4

×4           ×4

↓

V_{2} = 480 L

--------------------------------------------------------------------------------------------------------------

There's our answer! Feel free to comment if you have any questions about my answer :)

3 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Carbon disulfide is prepared industrially by reacting carbon with sulfur dioxide according to the above equation. If 70.8 g of c
Rus_ich [418]

Answer:

1.18 moles of CS₂ are produced by the reaction.

Explanation:

We present the reaction:

5C + 2SO₂  →  CS₂  +  4CO

5 moles of carbon react to 2 moles of sulfur dioxide in order to produce 1 mol of carbon disulfide and 4 moles of carbon monoxide.

As we do not have data from the SO₂, we assume this as the excess reagent. We convert the mass of carbon to moles:

70.8 g / 12 g/mol = 5.9 moles

Ratio is 5:1, so 5 moles of carbon react to produce 1 mol of CS₂

Then, 5.9 moles will produce (5.9 . 1) / 5 = 1.18 moles

8 0
3 years ago
In the reaction 2co ( g) + o2( g) → 2co2( g), what is the ratio of moles of oxygen used to moles of co2produced?
KIM [24]
In the reaction 2co ( g) + o2( g) → 2co2( g), the ratio of moles of oxygen used to moles of co2produced is 1:2.
8 0
3 years ago
When a metal bonds with another non-metal, what type of bond is formed?
Juli2301 [7.4K]
When a metal bonds with another non-metal an ionic bond is formed
6 0
3 years ago
Read 2 more answers
Other questions:
  • How many moles in<br> 53g of palladium<br> 216g of silver<br> 46g of tungsten
    14·2 answers
  • What are the components of black powder? What are the ratios of these components?
    9·1 answer
  • Scientists define work as the spending of energy.<br><br> True<br> False
    7·1 answer
  • When the oxide of generic metal M is heated at 25C, only a negligible amount of M is produced. MO2(s) &lt;---&gt; M(s)+O2(g) del
    5·1 answer
  • How many protons does mercury have?
    14·2 answers
  • What is the ph of H2?
    12·1 answer
  • To identify the limiting and excess reactants in a reaction.
    5·1 answer
  • Does ccl4 has resonance structures
    10·1 answer
  • A 50.0 mL sample of 0.10 M potassium nitrate is mixed with 100 mL of 0.25 M magnesium nitrate. What is the final concentration o
    14·1 answer
  • When electrical ___ betweens protons is greater than strong forces, the nucleus will be unstable.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!