1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
13

Chemistry and physics are so closely related that sometimes the fields overlap. Which of the following experiments might both ch

emists and physicists do?
A. Study the life cycle of a month.
B. Study how well a pesticide works on plants.
C. Study what kind of chemicals enter milk.
D. Study how the Suns hates affects pollution.
Chemistry
2 answers:
svetoff [14.1K]3 years ago
4 0

Answer: The answer is the Sun and pollution or whatever

Explanation:

Just did it on Apex

madreJ [45]3 years ago
3 0
I pick B Because Chemistry is all about plants and they can use a pesticide on plants
You might be interested in
An ecosystem includes the biotic and abiotic factors<br><br>true<br><br>false​
MariettaO [177]
True.

Every environment and ecosystem will include these factors.
8 0
3 years ago
Read 2 more answers
Describe the relationship between volume and temperature of an ideal gas, and explain it in terms of the kinetic molecular theor
melisa1 [442]

As temperature increases, the particles will gain kinetic energy causing it to move more rapidly and randomly. However, this causes the gas to expand as the particles will have more energy to roam freely. Hence as temperature increases, Volume increases.

This is based on Charles' Law stating that the volume of a gas is directly proportional to its absolute temperature.

3 0
3 years ago
Read 2 more answers
Lithium oxide + hydrochloric acid please
Morgarella [4.7K]

Answer:

Does lithium oxide react with hydrochloric acid?

Explanation:

Lithium Hydroxide reacts with acids to produce a Lithium salt: Hydrochloric Acid + Lithium Hydroxide → Lithium Chloride + Water. HCl + LiOH → LiCl + H2O. ... H2SO4 + 2LiOH → Li2SO4 + 2H2O

is this what you wanted to know?

5 0
3 years ago
Question 1 (3 points)
den301095 [7]

Answer:

Explanation:

ΔTemp => 35⁰C(108K) increases to 57.9⁰C(330.9L) => increases volume (Charles Law)

Use the Kelvin Temperature values in a ratio that will increase the original volume.

ΔVol = 6.33L(330.9/108.0) => gives a larger volume. Using 108.0/330.9 would give a smaller volume and would be contrary to what the problem is asking.

ΔPress => 342 mmHg increases to 821 mmHg => decreases volume (Boyles Law)

Use the pressure values in a ratio that will decrease the original volume.

ΔPress = 6.33L(342/821) => gives a smaller volume. Using 821/342 would give a larger volume and would be contrary to what the problem is asking.

Now, putting both ΔTemp together with ΔPress => net change in volume. (Combined Gas Law)

ΔVol = 6.33L(330.9/108.0)(342/821) = 8.08L (final volume of gas).

___________________

This problem can also be worked using the combined gas law equation:

P₁V₁/T₁ = P₂V₂/T₂ => V₂ = P₁V₁T₂/T₁P₂

V₂ = [(342mm)(6.33L)(330.9K)]/[(108K)(821mm)] = 8.08L (final volume of gas)

7 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • 2) which statement describes ionic bonding?
    5·1 answer
  • Brainliest will be awarded..!!
    11·1 answer
  • How many total atoms are in 0.450 grams of P2O5
    13·1 answer
  • Whatd to do to make the time go by faster
    11·2 answers
  • What is the dropping of a sediment called
    6·2 answers
  • What is the number of moles in 500L of He
    9·2 answers
  • How many atoms are in 1.22 moles of magnesium?
    13·2 answers
  • Four forces are exerted on each of the two objects shown below:
    8·1 answer
  • Students were shown models of two atoms and asked to make a list of similarities and differences between the models.Which statem
    15·1 answer
  • Which state of matter has the highest kinetic energy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!